ID: 1181769053

View in Genome Browser
Species Human (GRCh38)
Location 22:25112354-25112376
Sequence ACACCTGGCTTCCCGGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181769044_1181769053 4 Left 1181769044 22:25112327-25112349 CCCCTTCAAGCGTACTTCCTCCT No data
Right 1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 22
4: 142
1181769041_1181769053 14 Left 1181769041 22:25112317-25112339 CCAGCCGGACCCCCTTCAAGCGT No data
Right 1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 22
4: 142
1181769043_1181769053 5 Left 1181769043 22:25112326-25112348 CCCCCTTCAAGCGTACTTCCTCC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 22
4: 142
1181769046_1181769053 2 Left 1181769046 22:25112329-25112351 CCTTCAAGCGTACTTCCTCCTTC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 22
4: 142
1181769042_1181769053 10 Left 1181769042 22:25112321-25112343 CCGGACCCCCTTCAAGCGTACTT 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 22
4: 142
1181769045_1181769053 3 Left 1181769045 22:25112328-25112350 CCCTTCAAGCGTACTTCCTCCTT No data
Right 1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG 0: 1
1: 0
2: 0
3: 22
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181769053 Original CRISPR ACACCTGGCTTCCCGGAGTC GGG Intronic
900100137 1:958957-958979 ACGCGAGGCTGCCCGGAGTCCGG - Exonic
904415169 1:30356484-30356506 ACAACTGGATTCCTGGAGCCTGG + Intergenic
905036294 1:34920062-34920084 ACATCTGGCTTCAGGAAGTCTGG + Intronic
906281813 1:44559669-44559691 AGCTCTGGCTTCCTGGAGTCAGG - Intronic
906660739 1:47579574-47579596 ACCCCAGGCTGCCAGGAGTCAGG - Intergenic
920834945 1:209502146-209502168 GCACCTGGCTTCACAGAGTCTGG - Intergenic
923623788 1:235597996-235598018 GCAACTGGCTTCCCTGACTCTGG + Intronic
1067936085 10:50613273-50613295 ACACCTAGCCTCCCTGGGTCAGG - Intronic
1073452759 10:103619350-103619372 AATCCTGGATTCCCGGAGCCTGG - Intronic
1074106663 10:110394100-110394122 ACCCCATGCTTCCCGGAGGCAGG + Intergenic
1077546898 11:3175849-3175871 ACTCCTGGCTTCCTGGTGCCTGG - Intergenic
1078842457 11:15091544-15091566 GCATCTGGCTTCACAGAGTCAGG - Intergenic
1079281545 11:19091159-19091181 ATTCCTGGATTCCCGAAGTCTGG + Intergenic
1079915203 11:26361057-26361079 ATACTTGGTTTCCAGGAGTCAGG + Intronic
1080589410 11:33708424-33708446 ACTCCTGGCTTTCTGGAGTGTGG + Intronic
1080713027 11:34769575-34769597 ACGCCTTCCTTCCCAGAGTCAGG - Intergenic
1084001368 11:66296864-66296886 GCACCTGGCTCCCCTGACTCCGG + Intergenic
1084145879 11:67265268-67265290 ACACCTGGCTTTCCCCACTCTGG + Intergenic
1084296555 11:68216113-68216135 AGCCCTGGCTTCCCTGAGTGGGG - Intergenic
1085742339 11:79088013-79088035 ACACCTGGGTCACTGGAGTCTGG + Intronic
1086561290 11:88172680-88172702 ACACCTGGCTGACTGGAGTCTGG + Intronic
1088147067 11:106694166-106694188 ACACCTGGATTCCAGCATTCTGG + Intronic
1088791662 11:113232083-113232105 ACACCTGCCTTCCCAGTGCCAGG + Intronic
1090012008 11:123053677-123053699 ACACCTGTGTTCCCAGTGTCTGG - Intergenic
1090415057 11:126534931-126534953 CCACGTGGCGTCCCTGAGTCAGG + Intronic
1091189601 11:133680093-133680115 ACGGCTGGGTTCCGGGAGTCAGG - Intergenic
1097299518 12:58003420-58003442 ACTCCTGGCTTAAGGGAGTCTGG + Intergenic
1101728659 12:107408706-107408728 ACCCCTGGCTTCCCTGCCTCGGG + Intronic
1104547543 12:129725961-129725983 ACACTTGCCTTCTCAGAGTCTGG + Intronic
1104582171 12:130018975-130018997 TCAGCTGCCTTCCCAGAGTCAGG - Intergenic
1104763087 12:131309746-131309768 ACTCCTGCCTGCCCAGAGTCAGG - Intergenic
1104825168 12:131702617-131702639 GCACCTGGCCTCCCAGAGTGTGG + Intergenic
1106949550 13:34867890-34867912 ACCCCAAGCTTCCTGGAGTCAGG + Intergenic
1119984586 14:79122781-79122803 ACACCAGGCTTTACGCAGTCAGG + Intronic
1121797315 14:96745914-96745936 TCACCTGGCTTCCCAGTGTCAGG + Intergenic
1122347968 14:101072142-101072164 ACACCTGGCTGCTGGGTGTCAGG - Intergenic
1122696972 14:103560166-103560188 TCTCCTGGCTTCCCGGATGCAGG + Exonic
1122775890 14:104116858-104116880 GCACCTGGCCTCCCGGGTTCTGG - Intergenic
1122792163 14:104188605-104188627 ACACCTGGCTGCCCTCAGCCTGG - Intergenic
1122827716 14:104378993-104379015 GCAACTGGCTCCACGGAGTCAGG - Intergenic
1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG + Intergenic
1124212421 15:27774728-27774750 ACACCTGTTTTCCCGGATTGGGG - Intronic
1125180635 15:36878480-36878502 ACAGCTGGCTCCCCCGAGACAGG - Intergenic
1129550139 15:76439691-76439713 ACACCTGACTTACCTGAGTCTGG + Intronic
1129888855 15:79057765-79057787 GCACCTGGCTTCCCCAAGTGTGG - Intronic
1130217557 15:81986642-81986664 GAATCTGGCTTCCCGGAGTGTGG + Intergenic
1131597530 15:93813365-93813387 CCACCTGGCTTCCAGCAGTGGGG - Intergenic
1131918781 15:97300876-97300898 CCACCTGGCCTCACAGAGTCTGG - Intergenic
1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG + Intergenic
1133103362 16:3492450-3492472 ACACCTGGGTGCGCAGAGTCTGG + Intergenic
1133641721 16:7723605-7723627 ACCCTTGACTTCCTGGAGTCAGG - Intergenic
1135105492 16:19645761-19645783 ACACCTGGGTGACCTGAGTCAGG + Intronic
1137717112 16:50604770-50604792 ACACCTGCCTTCCCGAAGGATGG + Intronic
1139596323 16:67960368-67960390 ACACCTGGCTGCACAGGGTCAGG + Intronic
1139653305 16:68373374-68373396 ACACGTGGGTCCCCGGAGACTGG - Intronic
1141979355 16:87540496-87540518 ACGCCTGCCCTCCCGGTGTCAGG + Intergenic
1143854049 17:9835317-9835339 ATGCTTGGCTTCCAGGAGTCAGG + Intronic
1145017264 17:19407585-19407607 ACACCTGGCCTCCCTGGGCCAGG + Intergenic
1145800245 17:27678135-27678157 ACACCTGCCTTCCCAGGGTTTGG - Intergenic
1146148578 17:30445620-30445642 ACACCTGCCTTCCCAGGGTTTGG + Intronic
1147567846 17:41548531-41548553 ACTCATGGCTTCCCGGAGTTTGG - Intergenic
1148701690 17:49591089-49591111 ACACCTGGAGTCTAGGAGTCTGG - Intergenic
1150606596 17:66696836-66696858 ACACCTGGCACCCAGGAGGCTGG + Intronic
1151559282 17:74861896-74861918 ACACCAGCCTGCCCGGAGCCTGG + Intergenic
1152565660 17:81099262-81099284 ACACCTGGCTGCCTGGTTTCCGG - Intronic
1156324994 18:36067152-36067174 GCCCCCGGCTTCCCGGCGTCGGG - Intronic
1159582565 18:70249635-70249657 ACACCGGGCTTACTGGATTCTGG - Intergenic
1161686644 19:5706020-5706042 CCACCCAGCTTCCCGGAGCCAGG - Intronic
1161702003 19:5800711-5800733 ACCCCTGTCCTCCCGGAGGCTGG - Intergenic
1162976519 19:14209599-14209621 ACGCCTTGGTTCCCGGAGCCCGG - Intergenic
1163403151 19:17106657-17106679 ACACCTGTAATCCCAGAGTCAGG + Intronic
1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG + Intergenic
1168345583 19:55648815-55648837 ACTCCTGGGCTCCTGGAGTCAGG - Exonic
925869068 2:8253592-8253614 ACACCTGGCTCCCCGGCAGCTGG - Intergenic
928195580 2:29214361-29214383 CAACCTAGCTTCCCGGAGTCTGG - Intronic
933635555 2:84704897-84704919 CCACCAGGCTTCCAGGAGACAGG + Intronic
937528302 2:122797726-122797748 TCACCTGGCATCTCAGAGTCAGG + Intergenic
937861898 2:126717983-126718005 AGACCTGGCTCCCAGGGGTCAGG + Intergenic
938303034 2:130229495-130229517 ACGCGAGGCTGCCCGGAGTCCGG + Intergenic
938453635 2:131444727-131444749 ACGCGAGGCTGCCCGGAGTCCGG - Intergenic
938635331 2:133219314-133219336 TCACCTAGCTGCCCTGAGTCAGG - Intronic
941755655 2:169183002-169183024 AAAGCTGGCTTCCCTGATTCTGG - Intronic
947619003 2:231576662-231576684 AGACCTCGCTTCCCGGATGCTGG + Intergenic
948701988 2:239766331-239766353 ACTCCTGGCCTCCAGGTGTCCGG + Intronic
949070073 2:242019218-242019240 GCATCTAGCTTCCCGGAGTCAGG + Intergenic
1168801867 20:648647-648669 ACACCTGGCCTCCAGCAGGCTGG - Exonic
1169428240 20:5512691-5512713 ACCCCTCTCCTCCCGGAGTCTGG + Intergenic
1173479701 20:43389428-43389450 ACACCAGGCTTCCTGGACTCTGG - Intergenic
1174061445 20:47835725-47835747 GCATCTAGCTTCCTGGAGTCAGG - Intergenic
1174070081 20:47893598-47893620 GCATCTAGCTTCCTGGAGTCAGG + Intergenic
1174156312 20:48517627-48517649 GCATCTAGCTTCCTGGAGTCAGG - Intergenic
1174365311 20:50053141-50053163 ACCCCTGGCTGCCCAGAGCCAGG - Intergenic
1174493304 20:50919750-50919772 ACACCTTGCTTTCCGGCCTCTGG - Intronic
1175250962 20:57610034-57610056 ATCTCTGGTTTCCCGGAGTCTGG - Intronic
1175826923 20:61941574-61941596 ACACCTGGCATCCGTGAGTGGGG - Intergenic
1176360787 21:5995257-5995279 ACACATGGCCTCACAGAGTCTGG - Intergenic
1179762731 21:43543293-43543315 ACACATGGCCTCACAGAGTCTGG + Intronic
1179982997 21:44906091-44906113 ACACCTGCCTTCCTGGAGCAAGG + Intronic
1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG + Intronic
1182547073 22:31082617-31082639 ACACCTGGCTTCAGGAGGTCTGG + Intronic
1183359633 22:37376749-37376771 ACCTCTGGCCTCCCAGAGTCTGG - Intronic
1184975559 22:48058989-48059011 ACACCTGGCTACTCAGAGTGTGG + Intergenic
950361390 3:12451903-12451925 GCAGCTGGCTTCCCCGAGTGAGG + Intergenic
951322613 3:21264599-21264621 AAACCTGGCTTACTGGATTCAGG - Intergenic
953912310 3:46899245-46899267 AGCCCTGACTTCCCGGAGGCAGG + Intronic
962809910 3:138950917-138950939 TCAACAGGCTTCTCGGAGTCAGG - Exonic
964183251 3:153913125-153913147 ACACCTGGTTTCCCGGGATGTGG - Intergenic
968049279 3:195643096-195643118 GCATCTAGCTTCCCGGAGTCAGG + Intergenic
968098123 3:195946532-195946554 GCATCTAGCTTCCCGGAGTCAGG - Intergenic
968106628 3:196006048-196006070 GCATCTAGCTTCCCGGAGTCAGG - Intergenic
968305337 3:197646838-197646860 GCATCTAGCTTCCCGGAGTCAGG - Intergenic
969323896 4:6429833-6429855 ACACCTGGCTTCTCGGGGACTGG - Intronic
969362214 4:6672149-6672171 GCACCTGGCTTCTCGGAGCCTGG + Intergenic
969450530 4:7270392-7270414 ACAGGTGGCTTCCCGGAGCCGGG - Intronic
969489548 4:7491284-7491306 ACAACTGGCTTCCTGGAGGATGG - Intronic
969710186 4:8838854-8838876 ACGCCTGGCTTCTCAGAGTGTGG + Intergenic
970612263 4:17736763-17736785 ACACCTGGCCACACGGAGGCTGG + Intronic
981277639 4:142920528-142920550 ACACCTGGCTTCAAGGAGGCTGG - Intergenic
985505836 5:279932-279954 GCATCTAGCTTCCCGGAGTCAGG + Intronic
985742361 5:1625994-1626016 GCATCTAGCTTCCCGGAGTCAGG - Intergenic
985882993 5:2654555-2654577 ACCCCTGGCTTCCGAGAGACGGG + Intergenic
985894039 5:2738762-2738784 ACACCTGGCCTCCCGCAGGTGGG - Intergenic
987310678 5:16678600-16678622 ACAACTGGCTTGCCAGAATCTGG + Intronic
988066053 5:26229474-26229496 GCATCTAGCTTCCTGGAGTCAGG - Intergenic
988846104 5:35129918-35129940 TCACCTGGCTTCTTGGATTCTGG - Intronic
988907337 5:35802882-35802904 TCACCTGGCTTCACTAAGTCAGG + Intronic
992411613 5:76510814-76510836 ACACCTGGCCTCCAGCAGGCTGG + Intronic
995347311 5:111135431-111135453 ACATCTGCCTTCTCGGAGCCAGG + Intergenic
1002086997 5:176782148-176782170 TCCCCTGGCTTCTCAGAGTCTGG + Intergenic
1005750365 6:28876319-28876341 CCACCTGGCTTTCAGGATTCAGG + Intergenic
1006611693 6:35298004-35298026 ACACCTGGCTCCCAGGCGGCAGG - Intronic
1017009954 6:150056654-150056676 GCATCTAGCTTCCTGGAGTCAGG - Intergenic
1019427868 7:985872-985894 CCTCCTGGCTTCCCAGAGGCAGG + Intronic
1019884115 7:3889323-3889345 GCCCCTGGCATCCCAGAGTCAGG + Intronic
1024607428 7:51034017-51034039 ACAGCTGCCTTTCTGGAGTCTGG + Intronic
1025232995 7:57215350-57215372 GCATCTAGCTTCCTGGAGTCAGG + Intergenic
1028035011 7:85971680-85971702 ACACCTGGCTTGCCCTTGTCAGG - Intergenic
1034266726 7:149784726-149784748 ACACCTGGGTACCCAGTGTCTGG + Intergenic
1035262320 7:157669855-157669877 ACGCCTGGATGCCCGGAGCCCGG - Intronic
1035292511 7:157848856-157848878 ACACGGGGCTTCCCTGGGTCTGG - Intronic
1036642637 8:10593677-10593699 AGGCCTGGCTTCCAGGAGCCAGG + Intergenic
1037805098 8:22054576-22054598 ACACTGGGCTTCCTGGAGTGGGG + Intronic
1042187835 8:66154564-66154586 ACACCTGGCTTCCCAGGGGAGGG + Intronic
1046337069 8:112804441-112804463 ACATCTGGCTTCTCGCAGTATGG - Intronic
1048285659 8:133139411-133139433 AGACCTGGCTTCCAGAACTCTGG + Intergenic
1049422598 8:142523572-142523594 ATACCTGGCCTGCCGAAGTCAGG + Intronic
1049782568 8:144435604-144435626 ACACCTGCCTGCCCGGAGTGGGG + Intronic
1049975109 9:854024-854046 ACTCCTGGCTTCCAGCAGTCAGG + Intronic
1050406587 9:5314775-5314797 ACACCTGGCTTCACAGAATCTGG + Intergenic
1056642389 9:88382587-88382609 TCACCTGGGTTCCAGGAGGCTGG - Intergenic
1056822461 9:89853281-89853303 ACACCTGGCTGCCAGCAGCCTGG - Intergenic
1057299786 9:93871194-93871216 ACACCTGACCTCCCACAGTCTGG + Intergenic
1059429794 9:114243232-114243254 ACACCTGCCTTCAGGGAGTGAGG - Intronic
1060189397 9:121582466-121582488 ACACCTGGCTGCCCACAGTTGGG - Intronic
1061092703 9:128435577-128435599 ACACATGCCTGCCCGGAGCCAGG - Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1193162323 X:78241461-78241483 CCACCTGGCTACCAGCAGTCAGG - Intergenic
1196757304 X:119169275-119169297 ACACTTGACTTCAAGGAGTCAGG + Intergenic
1198204468 X:134452824-134452846 ACAAAGGGCTTCCAGGAGTCAGG + Intergenic
1199156149 X:144551214-144551236 ACACCTGGGGTCCCTGATTCAGG + Intergenic
1201919949 Y:19223475-19223497 ACACTTGGCTTCTTGGAGTCAGG + Intergenic
1202275932 Y:23119422-23119444 ACACCTGGCCTCACAGAATCTGG + Intergenic
1202290096 Y:23301269-23301291 ACACCTGGCCTCACAGAATCTGG - Intergenic
1202428926 Y:24753141-24753163 ACACCTGGCCTCACAGAATCTGG + Intergenic
1202441865 Y:24916948-24916970 ACACCTGGCCTCACAGAATCTGG - Intergenic