ID: 1181769339

View in Genome Browser
Species Human (GRCh38)
Location 22:25113982-25114004
Sequence GGTCACACCACTCCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181769339_1181769350 24 Left 1181769339 22:25113982-25114004 CCACCCTGGGGAGTGGTGTGACC 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1181769350 22:25114029-25114051 GGCGTCTTACCCTGTGTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 79
1181769339_1181769346 3 Left 1181769339 22:25113982-25114004 CCACCCTGGGGAGTGGTGTGACC 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1181769346 22:25114008-25114030 GGCATTGGCATGAATCCCCTAGG 0: 1
1: 0
2: 0
3: 16
4: 113
1181769339_1181769351 28 Left 1181769339 22:25113982-25114004 CCACCCTGGGGAGTGGTGTGACC 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1181769351 22:25114033-25114055 TCTTACCCTGTGTTACAGGTTGG 0: 1
1: 0
2: 1
3: 24
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181769339 Original CRISPR GGTCACACCACTCCCCAGGG TGG (reversed) Intronic
900487051 1:2927793-2927815 GGTCATACCTCTCACCAGGACGG - Intergenic
902636512 1:17738300-17738322 GGTGACACCACCCACCAGGTGGG - Intergenic
903004638 1:20290667-20290689 GGCAGCCCCACTCCCCAGGGAGG + Intergenic
904458082 1:30659090-30659112 GGGCACAGCCGTCCCCAGGGAGG + Intergenic
905318902 1:37101677-37101699 TGTCACGCCACTTCACAGGGAGG - Intergenic
905803038 1:40857859-40857881 AGTCACACCACTTCTCTGGGTGG + Intergenic
906034892 1:42744288-42744310 GGTCACACAACTCCACATGGTGG + Intergenic
906160157 1:43642210-43642232 TGTCACTCCATTCCCCAGGCTGG + Intergenic
906212702 1:44021046-44021068 TGTCACACCATTTCCCAGGCTGG - Intronic
906638549 1:47427017-47427039 CGGCACAGCACACCCCAGGGTGG - Intergenic
907866460 1:58404129-58404151 TGTCTCACCACTCCCCTGGATGG - Intronic
910870191 1:91826386-91826408 AGTCACACCACTCACCACAGCGG - Intronic
912075841 1:105873919-105873941 GGTCACACCAGATCCCAAGGAGG - Intergenic
912455139 1:109792115-109792137 GCTAAAAACACTCCCCAGGGAGG - Intergenic
912798938 1:112709183-112709205 GGTCTCACTATTGCCCAGGGTGG + Intronic
914673192 1:149887597-149887619 GGTGTCACCATTGCCCAGGGCGG - Exonic
916711905 1:167418476-167418498 AGTTTCACCACTCCCAAGGGAGG - Exonic
919145564 1:193630072-193630094 GGTCACAAAAATCCCCAGTGAGG - Intergenic
919901336 1:202046281-202046303 GCCCACATCACACCCCAGGGGGG - Intergenic
924424231 1:243935937-243935959 GGTCTCAACACTCCCCAGAAAGG - Intergenic
1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG + Intergenic
1066705613 10:38174743-38174765 GGTCACACGACTGCTCAGGCTGG - Intergenic
1066984834 10:42455613-42455635 GGTCACACGACTGCTCAGGCTGG + Intergenic
1069879175 10:71581087-71581109 GGTCACAGCCCTCTCCTGGGTGG + Intronic
1070774880 10:79103684-79103706 GGGCACACCAGGCCCCAGGCTGG + Intronic
1073058330 10:100716149-100716171 GGTCACACCTCTTCCGCGGGAGG + Intergenic
1076826758 10:132973294-132973316 GCTCACCCCTCTTCCCAGGGTGG - Intergenic
1078106641 11:8361953-8361975 GGTCAGACACCTCCCCAGGACGG + Intergenic
1079502679 11:21119492-21119514 GGAAACCCCAGTCCCCAGGGAGG - Intronic
1080736548 11:35021777-35021799 GCTCACACCACTACCAAGGCAGG - Intergenic
1081867342 11:46367001-46367023 GGTCACACCACTCGCCCTGCTGG - Intronic
1083266210 11:61548110-61548132 GGTCACCCCACTCCCCTGAAAGG + Intronic
1083640566 11:64143082-64143104 GGTCACACTGTTCCCCAGGCTGG - Intronic
1085277980 11:75312162-75312184 GAGCTCACCACTCCCCGGGGAGG - Intronic
1086561898 11:88177844-88177866 TGTCACCTCACTTCCCAGGGAGG + Intergenic
1088351032 11:108887871-108887893 GATCACACCACTCTCCAGCCTGG + Intronic
1089191635 11:116658246-116658268 GCTCACAGCACTGCCCAGTGGGG + Intergenic
1089365702 11:117919710-117919732 GGCCTCACCACACCCCTGGGAGG + Intronic
1095088978 12:38086684-38086706 GGTCTCACCAAGCCCCAGGCAGG - Intergenic
1095603210 12:44037744-44037766 GGTCACTCCTCTCCACAGGCAGG - Intronic
1095880411 12:47129803-47129825 AGGCACACCACTCCCCACTGGGG - Intronic
1097289230 12:57899996-57900018 GATCACACCACTACCCAGCATGG - Intergenic
1101489328 12:105197073-105197095 GGCCACTCCTCTCCCCAGGCAGG + Intronic
1102526489 12:113515746-113515768 GGTCACACAACTCTCAGGGGTGG - Intergenic
1103145142 12:118589187-118589209 GGACACTCCACACCCCAGGCTGG + Intergenic
1107389200 13:39945575-39945597 GGTCACAACACTCTCATGGGTGG - Intergenic
1113892636 13:113744364-113744386 GGTGAAACCACTCTCCGGGGGGG - Intergenic
1118387713 14:65270220-65270242 GGTCTCACTACTGCCCAGGCTGG - Intergenic
1122788436 14:104174470-104174492 GGGCTCCCCACCCCCCAGGGAGG - Intronic
1123480662 15:20628669-20628691 GGCAGCACCGCTCCCCAGGGAGG - Intergenic
1123637347 15:22371698-22371720 GGCAGCACCGCTCCCCAGGGAGG + Intergenic
1125744788 15:41990804-41990826 GGTCACTCTAATCCCCAGAGTGG + Intronic
1125998090 15:44183395-44183417 GGGCCCACCACTCCACAGGAAGG + Intronic
1127289417 15:57557006-57557028 GGTCTTACCACTCCCCGGTGTGG - Intergenic
1128375582 15:67072717-67072739 GGTCATACCCCTCCTTAGGGAGG - Intronic
1128807023 15:70538737-70538759 GGTCACACCTCTCCCCAAGGAGG + Intergenic
1129931270 15:79412806-79412828 GGTCACAACACTCCAATGGGTGG - Intronic
1131436672 15:92428460-92428482 GGTCTCCCCTCTCCCCAAGGAGG + Intronic
1132863547 16:2082980-2083002 GGTCACAGCACTCCCCACCAGGG - Intronic
1135607019 16:23834197-23834219 GGCCCCACCACCTCCCAGGGAGG - Intergenic
1139368925 16:66452830-66452852 GGACACACAGCTCCCCAGGATGG + Intronic
1144641926 17:16942274-16942296 GGTCTCACCAATTCCCAGGCCGG + Intronic
1144789243 17:17848259-17848281 GGCCAGACCGCTCCGCAGGGAGG - Intronic
1145009330 17:19358638-19358660 GGTCTCTCCACTGCACAGGGTGG + Intronic
1146280447 17:31541115-31541137 GATCAAGCTACTCCCCAGGGCGG + Intergenic
1147261643 17:39212478-39212500 GGTCCCATCATCCCCCAGGGTGG - Intronic
1148346785 17:46908574-46908596 ACTCACAGCAGTCCCCAGGGTGG - Intergenic
1152438490 17:80290197-80290219 TGACACACCACCCCCCATGGAGG - Intronic
1152512258 17:80798359-80798381 GGCCACGCCACCTCCCAGGGAGG + Intronic
1152718272 17:81910335-81910357 GGTCACACCTCTCCCTGGAGAGG - Intronic
1155414364 18:25581509-25581531 GATAACACCACTCCCTAGGGAGG + Intergenic
1155888779 18:31240750-31240772 GGTCTCACCATTGCCCAGGCTGG + Intergenic
1160550418 18:79691437-79691459 GGTCACACAGCTTCCCAGGCAGG + Intronic
1160723412 19:607308-607330 GGGCACAGCACTCCCCAGGCAGG - Intronic
1161596442 19:5153360-5153382 GGTCACACCCATCCCCTGGTGGG + Exonic
1161791993 19:6365625-6365647 GGTCTCACCATTGCCCAGGCTGG - Intronic
1162597316 19:11639553-11639575 GGTCAGGTCACTGCCCAGGGAGG + Intergenic
1162789732 19:13056576-13056598 GGTCCCACCCCACTCCAGGGAGG - Intronic
1162850223 19:13425425-13425447 AGACACACCACTCCCCAAGTAGG + Intronic
1163090059 19:15013181-15013203 GGTCTCATCTCTCCCCCGGGAGG - Intronic
1163157154 19:15445805-15445827 GGGCACACCCCTGCCCAGGCAGG + Intronic
1163265225 19:16216835-16216857 GGTCACAACACTCCAATGGGTGG + Intronic
1163293099 19:16393721-16393743 GATCCCACCACACTCCAGGGTGG + Intronic
1166334104 19:42095253-42095275 GGTCTCCCCACCCCCCAGGCGGG + Intronic
1166935484 19:46329929-46329951 GGTCTCACCATTGCCCAGGCTGG - Intronic
1167093060 19:47357967-47357989 GGTCACCCCGCTCCTCAGGCGGG - Exonic
1167247795 19:48384153-48384175 GGAGACCCCAGTCCCCAGGGAGG + Intronic
925753874 2:7115025-7115047 GGTCTCAGCACACCCCAGGCAGG - Intergenic
926625163 2:15085044-15085066 CGTCACAGCAGCCCCCAGGGCGG - Intergenic
931397018 2:61896533-61896555 GATCACACCACTGCACTGGGTGG + Intronic
934524518 2:95043398-95043420 GTTCACACCAGCCCCCAGTGTGG + Intronic
937059785 2:118972379-118972401 GATCACACCATTGGCCAGGGAGG + Intronic
941170753 2:162132726-162132748 GGTAACACCATTCTCCTGGGAGG - Intergenic
941717700 2:168780983-168781005 CATCACATCACTACCCAGGGAGG + Intergenic
944272962 2:197804467-197804489 GGGCACACCCCTCCGCAGTGAGG + Intergenic
945028821 2:205644468-205644490 GCACACATCACTCCCTAGGGAGG + Intergenic
945587333 2:211682509-211682531 GGTCAACCCACTCCCCAGTTAGG + Intronic
946028230 2:216685249-216685271 TGTCACACTATTGCCCAGGGGGG - Intronic
946428252 2:219611406-219611428 GATCACTCCCCACCCCAGGGAGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947874972 2:233461832-233461854 AGTCACACCAGGTCCCAGGGAGG - Intronic
948888039 2:240893565-240893587 GGTCTCACCGGTTCCCAGGGTGG + Intronic
1168828325 20:829300-829322 TCTCTCACCACTCCCCATGGTGG + Intergenic
1168955359 20:1830603-1830625 TGTCACATCAGTCCCCAGAGGGG - Intergenic
1170692316 20:18626892-18626914 AGTCACTGCACTCCTCAGGGAGG - Intronic
1171522666 20:25787484-25787506 GGACACCCCTCTCCCCTGGGAGG + Intronic
1171530412 20:25849453-25849475 GGACACCCCTCTCCCCTGGGAGG + Intronic
1171554161 20:26068399-26068421 GGACACCCCTCTCCCCTGGGAGG - Intergenic
1172277076 20:33685822-33685844 GGTCACCCCGCACCCCAGGGCGG + Intronic
1173295325 20:41750267-41750289 GGTCCCTCCCCTCCCCTGGGAGG - Intergenic
1179453275 21:41480111-41480133 GGTCCAACCTCTACCCAGGGAGG + Intronic
1179995617 21:44972720-44972742 GTACACACCACTTCCCAGGAAGG - Intronic
1180651725 22:17382870-17382892 GGTCTCACTGCTGCCCAGGGGGG - Intronic
1180701810 22:17785295-17785317 GGTCACAGCACTCACCCGGCCGG - Intergenic
1181648297 22:24245595-24245617 GGTCCCACAACTCCCCAGGGTGG + Intergenic
1181769339 22:25113982-25114004 GGTCACACCACTCCCCAGGGTGG - Intronic
1182349478 22:29691192-29691214 GGGGACTCCACTCCCCAGGCAGG + Intronic
1183098415 22:35568453-35568475 AGTCTCTCCACTGCCCAGGGCGG + Intergenic
1183657412 22:39195726-39195748 GTTCTCACCATTGCCCAGGGTGG - Intergenic
1184471187 22:44697367-44697389 GGTGACACCACTGCCCTGTGAGG - Intronic
1184507759 22:44914427-44914449 GGCCACACCTCTCCCCAGGGAGG + Intronic
1184806314 22:46796872-46796894 GGTCTCACCAGTGCCCTGGGAGG - Intronic
1185314736 22:50174184-50174206 GGTGTCCCCACTCCCCAGGTGGG + Intronic
953298907 3:41751618-41751640 AGTCACAGCAATTCCCAGGGAGG + Intronic
954449128 3:50562295-50562317 GGGCCCACCAGTCCCCAGGCCGG - Intronic
954509229 3:51106949-51106971 GGTCACAACACTCTGCTGGGTGG - Intronic
955177208 3:56628788-56628810 GGTCTCACCATTGCCCAGGCTGG + Intronic
960617966 3:119613509-119613531 GGCCATTCCACTCCCCAGGCAGG + Intronic
966819136 3:183911141-183911163 GGCCATGCCACTCACCAGGGTGG + Intergenic
967070966 3:185961881-185961903 GGAGACACCACTTCACAGGGTGG - Intergenic
968081050 3:195847295-195847317 GGTCTCTGCTCTCCCCAGGGAGG + Intergenic
968211077 3:196849277-196849299 GGTTACACCACTCCAGAGCGGGG + Intergenic
968760793 4:2442059-2442081 TGTCCCACCACACCCCAGTGAGG + Intronic
968921131 4:3522746-3522768 GGCCACTTCACTCCCCAGGCAGG - Intronic
969284997 4:6197613-6197635 GGTCACTCCTCTCCCCATAGTGG - Intronic
972817237 4:42657340-42657362 GGTCAACCAACTCCACAGGGCGG - Intergenic
974066390 4:57081522-57081544 GGTCACACCACACACCAAGAAGG - Intronic
984944702 4:184961873-184961895 GGCCACACCCATCCTCAGGGCGG - Intergenic
985766126 5:1780415-1780437 GCTGCCACCACTGCCCAGGGAGG + Intergenic
987951904 5:24687073-24687095 GGTAACTCCTCTCCACAGGGAGG + Intergenic
988685198 5:33518985-33519007 GGTCAGGCCACAGCCCAGGGTGG - Intergenic
991581069 5:68155686-68155708 GATCGCACCACTGCCCAGCGTGG + Intergenic
992513586 5:77467964-77467986 GATCACACCACTCTCCAGCCTGG + Intronic
995048773 5:107678009-107678031 GATCACACCACTCTCCAGCCTGG + Intergenic
1001479359 5:172076954-172076976 CGTCACACCACTGACCATGGAGG + Intronic
1002817891 6:695892-695914 TGTCACACAACTCCTCAGAGGGG - Intergenic
1004449386 6:15730812-15730834 GGTCACCCCCCTTCCCAGAGTGG - Intergenic
1006633068 6:35443189-35443211 CCTAACACCACTCCCCAGAGGGG - Intergenic
1012668928 6:102015738-102015760 GGTCACAACACTCTGAAGGGTGG - Intronic
1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG + Intergenic
1017497826 6:154996422-154996444 GGTCTCACCATTACCCAAGGAGG - Intronic
1017789291 6:157782019-157782041 GGCCACAAAACTCCCCTGGGAGG - Intronic
1018235726 6:161721745-161721767 GGTGACACCATGACCCAGGGAGG - Intronic
1018896969 6:168026197-168026219 GGTCACACGATCCCCGAGGGTGG - Intronic
1019487110 7:1294400-1294422 GGTCACACCCCTGCCCAGGAGGG + Intergenic
1019525986 7:1480780-1480802 GGCCCCACCCCTCCCCAGGCTGG + Intronic
1020230032 7:6311350-6311372 GGTCTCACTGCTCCCCAGGCTGG - Intergenic
1022562423 7:31363672-31363694 TGTCACACCATCCCCCACGGTGG - Intergenic
1022877877 7:34553345-34553367 GGTCACAACACTCCAATGGGTGG - Intergenic
1023518858 7:41030844-41030866 GGTCAGACCACCCCCAAGGGAGG + Intergenic
1027135921 7:75623869-75623891 GGTCTCACTACTCCCCAGGCTGG - Intronic
1029623931 7:101707849-101707871 TGGCACTCCACTCCCCAGGGAGG + Intergenic
1030072088 7:105706655-105706677 GATCACCCCAGTCCCCAGAGGGG - Intronic
1030158774 7:106485618-106485640 TGTCACACCCTTTCCCAGGGTGG - Intergenic
1030159412 7:106492004-106492026 TGTCACACCCTTTCCCAGGGTGG - Intergenic
1032003745 7:128283804-128283826 GGTGACACCACTGGCCAGGGTGG + Intergenic
1032401333 7:131626364-131626386 GGTCACCAGACTGCCCAGGGAGG - Intergenic
1032427142 7:131831265-131831287 CATCACCCCAATCCCCAGGGAGG + Intergenic
1033186649 7:139232117-139232139 GCTTTCTCCACTCCCCAGGGTGG + Intronic
1033581418 7:142740531-142740553 GGTCAGACATCTCCCCAGGCAGG - Intergenic
1034420741 7:150989273-150989295 GGGCACAGCCCTCCCCAGGGAGG + Intergenic
1037155566 8:15694822-15694844 GGTCACAACACTCCCATGAGTGG + Intronic
1037912078 8:22749477-22749499 GGTGACACCCCTGACCAGGGAGG - Intronic
1038450271 8:27634783-27634805 GGACTGACCTCTCCCCAGGGTGG + Intronic
1039431432 8:37528316-37528338 GGTGGCACCTCTCCCTAGGGAGG - Intergenic
1043405513 8:79928299-79928321 GCTCACTCCATTGCCCAGGGTGG - Intronic
1043738418 8:83775837-83775859 GGTCACAACACTCCCATGGGTGG - Intergenic
1049004810 8:139847818-139847840 GCTCACACCCATCCCCAGGCCGG - Intronic
1049497556 8:142943459-142943481 GGGCACACCAGTCCCCACGTCGG + Intergenic
1053916754 9:42949603-42949625 GGCCACAGCAGTCCCCGGGGAGG - Intergenic
1055281211 9:74676591-74676613 GGCCACACCACACCTCTGGGTGG + Intronic
1055890880 9:81122500-81122522 GGTCACTCCTCTCCGCAGGTAGG + Intergenic
1057383765 9:94590449-94590471 GGACACACCACCACCCAGGCAGG - Intronic
1057725149 9:97563246-97563268 GGTCACACCATTGCCCAGACTGG + Intronic
1060796804 9:126517350-126517372 GGTCCCACTCCTCCCCAGTGCGG - Intergenic
1061722354 9:132560416-132560438 GGTAACACCAGTCCCAAGGTGGG - Intronic
1061947414 9:133916486-133916508 AGTCCCAGCACTTCCCAGGGTGG - Intronic
1186885593 X:13910119-13910141 AGCCACACCACCCTCCAGGGTGG - Intronic
1187460607 X:19483684-19483706 GGTCACCCCAATCCACATGGAGG + Intronic
1188051396 X:25491315-25491337 TGTTACACCACGCCCCAAGGAGG - Intergenic
1189558035 X:42165636-42165658 GGTCACAACACTCCAATGGGTGG + Intergenic
1191255924 X:58279633-58279655 GGCCTCACGACTCCCCTGGGTGG + Intergenic
1193749558 X:85326078-85326100 GGTCACAACACTCCTATGGGTGG + Intronic
1195263123 X:103153581-103153603 CATCTCACCACACCCCAGGGAGG - Intergenic
1196584177 X:117409876-117409898 GGTCACAGCACTCCAATGGGTGG - Intergenic
1196785049 X:119414775-119414797 GGTCTCACTACTGCCCAGGCTGG + Intronic
1200235004 X:154463905-154463927 GGTCCCGCCACTGCCCCGGGAGG - Intronic
1201772194 Y:17625696-17625718 TGCCAAACCACTTCCCAGGGCGG - Intergenic
1201829361 Y:18280290-18280312 TGCCAAACCACTTCCCAGGGCGG + Intergenic