ID: 1181770746

View in Genome Browser
Species Human (GRCh38)
Location 22:25123584-25123606
Sequence CTCTCTACAGGGCTGCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181770746_1181770752 -8 Left 1181770746 22:25123584-25123606 CCCTCAAGCAGCCCTGTAGAGAG 0: 1
1: 0
2: 4
3: 27
4: 156
Right 1181770752 22:25123599-25123621 GTAGAGAGGCCCATATGGTGAGG 0: 1
1: 1
2: 13
3: 64
4: 316
1181770746_1181770756 23 Left 1181770746 22:25123584-25123606 CCCTCAAGCAGCCCTGTAGAGAG 0: 1
1: 0
2: 4
3: 27
4: 156
Right 1181770756 22:25123630-25123652 CCTCCAGTCCACCACCAGCAAGG 0: 1
1: 0
2: 0
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181770746 Original CRISPR CTCTCTACAGGGCTGCTTGA GGG (reversed) Intronic
900714987 1:4138428-4138450 CTCTCTGCAGAGCTTCTTGCAGG - Intergenic
902468493 1:16632071-16632093 TACTCTACAGGGCTGCTGGGAGG + Intergenic
903744631 1:25578294-25578316 CTCTCTGGAGGGCTGCTTGAGGG - Intergenic
903774376 1:25783348-25783370 TTCTCTGCAGGGGTGCCTGAGGG - Intronic
905668998 1:39778954-39778976 ATCTCTGCAGGGTTGCCTGAAGG - Intronic
906093717 1:43205325-43205347 AGCTCTACAGCTCTGCTTGAGGG - Intronic
909334698 1:74458572-74458594 CACTCTACAGTGTTTCTTGATGG + Intronic
910366109 1:86467076-86467098 CTCTCCAAAGGGCTGCTCCAAGG + Intergenic
910849013 1:91632814-91632836 CTCTCTGCAAGGCTGGGTGATGG + Intergenic
910926223 1:92400710-92400732 GCCTCTAAAGGGCTGCTTGGTGG - Exonic
918184468 1:182114716-182114738 CTGTTTCCATGGCTGCTTGATGG + Intergenic
918185814 1:182126747-182126769 CTTTTAACAGGGCTGCTTTATGG + Intergenic
920246034 1:204588493-204588515 GTCTCTGAAGGGCTCCTTGATGG + Intergenic
920915269 1:210253483-210253505 CTCTCTCCAGGGCACCTTGTGGG - Intergenic
921924718 1:220702014-220702036 CTCTCTAAAGGGCTGCTCCTCGG - Intergenic
922509709 1:226153961-226153983 CTCTCCATAGGGCTTCTTGAGGG - Intronic
923950557 1:238947348-238947370 CTCTCCACAGCGCTACTTGAGGG + Intergenic
924445872 1:244130055-244130077 CTCTAGATAGGGCTGCTTCATGG + Intergenic
924834553 1:247635730-247635752 CCTTCTACAGGGCAGCTAGAAGG - Intergenic
1063163376 10:3437443-3437465 CCATCCAAAGGGCTGCTTGAAGG - Intergenic
1064312775 10:14226560-14226582 CTCTCTTCTGGGCTGGTAGATGG + Intronic
1067186210 10:44030122-44030144 CTGTCTAAAGGACTGCTTGAAGG - Intergenic
1067735420 10:48846667-48846689 CTCACCACTGGGCTGCCTGAGGG - Intronic
1067990222 10:51203585-51203607 CTTTCCACAGTGCTGTTTGAGGG - Intronic
1068094249 10:52470427-52470449 AACTCTCCAGGGCTGCTTGAAGG + Intergenic
1072625613 10:97109390-97109412 CTCTCTCCAGAGGTGCTTAAAGG + Intronic
1073104227 10:101023145-101023167 CTCTCTACAGGGGTGCTGTAAGG - Intronic
1073155479 10:101343145-101343167 CTCTCCATAGGGCTGCTTATGGG - Intergenic
1074409359 10:113211954-113211976 CTTTCTTCAGAGCTTCTTGAAGG + Intergenic
1075090612 10:119442218-119442240 GTCTCTGCAGGGCTGCTGGGGGG + Intronic
1077507088 11:2934787-2934809 ACCTCCACAGGGCTGCTTGTGGG + Intergenic
1079410521 11:20183122-20183144 CCCTCTGCAGGGCTGGCTGATGG + Intergenic
1083751011 11:64760535-64760557 GTCACTTCAGGGCTCCTTGAGGG - Intergenic
1084458347 11:69282147-69282169 TTTTCTAGTGGGCTGCTTGAGGG - Intergenic
1085108188 11:73864192-73864214 TTCTCTACAGAGCTGGTTCAAGG + Intronic
1085453725 11:76654436-76654458 CTCTTTCCAGGGCAGCTTGGTGG + Intergenic
1087129414 11:94655490-94655512 CTCTCCACTGGGCTGCCTGAGGG - Intergenic
1089319314 11:117614085-117614107 CTCTCTCCAGGGCAGCTTAGTGG - Intronic
1090650890 11:128804863-128804885 TGCTCTTCAGAGCTGCTTGAAGG + Intronic
1091554524 12:1562449-1562471 CTTTCTACAGTGCTGCAGGATGG + Intronic
1092529598 12:9333489-9333511 CTCTCTGCATGGCTAGTTGATGG + Intergenic
1092874316 12:12834904-12834926 CTCTGTACAGAGCTGAGTGAGGG + Intergenic
1095396058 12:41763669-41763691 CTCTCTAAAGGGCTGCTTCTGGG - Intergenic
1096043731 12:48543612-48543634 CTGTCTCCAGGACTCCTTGATGG + Intergenic
1096249259 12:50017293-50017315 CTCTCTGCTGGGCTGCGTGCAGG + Intronic
1096850966 12:54436832-54436854 CTCTCCATAGGGCTGCTTGGTGG - Intergenic
1097278441 12:57829135-57829157 CTCCTTACAGGGCTGCTGGCTGG + Intronic
1099013167 12:77316013-77316035 CTCCCTACAGGGCTGAATGAGGG + Intergenic
1099898293 12:88676655-88676677 CTCTGCAAAGGGCTGCTTGCTGG - Intergenic
1100854392 12:98746022-98746044 CTCTCTGCAGGGCACCCTGAGGG + Intronic
1102391958 12:112556549-112556571 CACTCAAGAGGGCAGCTTGAGGG + Intergenic
1102490221 12:113286098-113286120 CTGTGGGCAGGGCTGCTTGAGGG - Intronic
1103869480 12:124081085-124081107 CTCTCTCCAGGGCAGCCTGTAGG - Intronic
1104469638 12:129019154-129019176 CTCTCCACTGGGCTGCTTGAGGG - Intergenic
1105948251 13:25208021-25208043 CTCTCTAAAGGGCTGCTTCTGGG + Intergenic
1106345657 13:28874584-28874606 CTTTCTGTGGGGCTGCTTGAGGG + Intronic
1107424016 13:40275160-40275182 CTCTCTGCAGGGCAGATTTAAGG + Intergenic
1107942150 13:45384195-45384217 CTCCTTTCAGGGCTGGTTGAAGG + Intergenic
1112634710 13:101202625-101202647 CTCTCCACAGGGCAGCTGGATGG - Intronic
1113431447 13:110255127-110255149 CCCTGCACAGGGCTGCCTGAAGG + Intronic
1113894323 13:113754174-113754196 CTCACTACAGGGAGGCTGGAAGG - Intergenic
1117555970 14:56884188-56884210 CTCTCTCCATGGCTGCATTATGG - Intergenic
1119172334 14:72544835-72544857 CTCTCTGCAGAGCTGCCTGGAGG - Intronic
1119470868 14:74898122-74898144 CTCTTTACAGGGCTCCTTCATGG - Intronic
1119888407 14:78163984-78164006 CTCACTACAGGGATACCTGAGGG - Intergenic
1120330181 14:83082473-83082495 CTTTCTTTAGGGCTGCTTGAGGG + Intergenic
1121572165 14:94954597-94954619 CTGGCTACAGGGCTGATTCATGG + Intergenic
1202891675 14_KI270722v1_random:165040-165062 CTTTCTTCACTGCTGCTTGAAGG + Intergenic
1125022036 15:34995558-34995580 CTCATTACAGGGCTGATTAAAGG - Intergenic
1125356636 15:38823226-38823248 ATCTCCACTGAGCTGCTTGAGGG + Intergenic
1126827982 15:52570265-52570287 CTCTCTGCAGTTCTGCTTAAGGG - Intergenic
1129754198 15:78086433-78086455 CTTTCTACATGGCTGCTGGTTGG - Intronic
1130374757 15:83318872-83318894 CTCTCCATATGGCTGCTTGAGGG - Intergenic
1132671677 16:1104495-1104517 CACCCTACGGGGCTGCTTCACGG + Intergenic
1135596138 16:23744806-23744828 TTCTCCACAGGGCAGCCTGAGGG - Intergenic
1138196053 16:55053053-55053075 CTCTCTCCAAAGCTGCTTAAAGG + Intergenic
1141717456 16:85735052-85735074 CTGTGTACAGGACTGCTTTAAGG + Intronic
1144282907 17:13744722-13744744 CTCTCTCCTGGGCTTGTTGACGG + Intergenic
1147497687 17:40933331-40933353 CTCTCCACAGTGCTGCTTAGGGG + Intronic
1147949247 17:44097825-44097847 CTCTCTGCAGGGCTCCTGCAAGG - Intronic
1148576835 17:48718483-48718505 TCCTCTACAGGGCTGCGGGAGGG + Intergenic
1150925325 17:69526517-69526539 GTTTCAACAGGGCTGCTTTAGGG - Intronic
1153842058 18:9016195-9016217 CTCTCTAGAGGTCTGCTTCTGGG - Intergenic
1155493080 18:26418691-26418713 TTCTTTCCAGGGCTGCTTGGAGG + Intergenic
1155530464 18:26761305-26761327 CTCTCTACAGGGCTCGGAGAAGG - Intergenic
1156479545 18:37427385-37427407 CTCTCCCCAGGGCTGCATGGGGG + Intronic
1158215293 18:55094736-55094758 CTCTCTACAGGGCAGGTTTCAGG - Intergenic
1161539951 19:4844592-4844614 CTCTCTACACCTCTGCTTCATGG - Intronic
1163035402 19:14566495-14566517 CTCTCTAGGGGCCTGTTTGATGG - Intronic
1163440900 19:17322175-17322197 CGCTCTGCAGGGCTGCTGGGCGG + Exonic
1166080646 19:40442074-40442096 CTCTCTACAGGGCATCATGGTGG - Exonic
1167016806 19:46846334-46846356 CACTCCACAGGGGTGCTGGAGGG - Intronic
1168726358 19:58584503-58584525 CTCACATAAGGGCTGCTTGAGGG + Intergenic
926324362 2:11771519-11771541 TTTACTACAGAGCTGCTTGACGG - Exonic
928239334 2:29572866-29572888 CGCTGTCCAGGGCTGCGTGAAGG - Intronic
929648962 2:43658656-43658678 GTCTCCACAGGACTGCTTGAGGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932838824 2:75062107-75062129 CTGTCAACAGGGCTTCTTGCTGG - Intronic
933366686 2:81362486-81362508 CTCTCTTCAGGGCTGTCAGACGG + Intergenic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
937001786 2:118474415-118474437 CTCTCTGCAGGGTTGCTACAGGG - Intergenic
937842402 2:126536823-126536845 CTCTCCCCAGGGCTGCTTAATGG + Intergenic
940961544 2:159792227-159792249 TTCTACACAGGGGTGCTTGAGGG + Intronic
942501400 2:176594445-176594467 CTTTCTACAGAGCTGATTGAAGG + Intergenic
1169317052 20:4601576-4601598 CTCTCTTCAGGGCCGTTTTAAGG + Intergenic
1170018922 20:11814009-11814031 CTCCCATCAGGGCTGCTTGCAGG - Intergenic
1171141341 20:22746464-22746486 CTCTCCACAGGGATGCTTGAGGG - Intergenic
1173033125 20:39380622-39380644 CTCTCTGCAGGGCTGCCTCATGG - Intergenic
1176258402 20:64166030-64166052 TCCTCTACAGGGCTGACTGAGGG + Intronic
1179117335 21:38505883-38505905 CTCTCTAAAGGCCTTTTTGAGGG - Intronic
1181770746 22:25123584-25123606 CTCTCTACAGGGCTGCTTGAGGG - Intronic
1182436301 22:30332769-30332791 CTCTCTAGAGGGCAGCTCAAAGG + Exonic
1183144954 22:35981946-35981968 CTCTCTACAGGGATAATTGTGGG - Intronic
949134702 3:549906-549928 CTCTCTCCTGGGCTGGTAGATGG - Intergenic
949437730 3:4047540-4047562 CTCCCCACTGGGCTGCCTGAGGG - Intronic
950987551 3:17391281-17391303 CTCTCTAATGTGCTGCTTTACGG - Intronic
951833750 3:26959221-26959243 CTCTCTTCAGAGCTGCCAGATGG + Intergenic
954068419 3:48125356-48125378 TCCTCCACAGGGCTGCTTCAGGG + Intergenic
954441687 3:50525606-50525628 CACACTACTGGGCTGCTTCAGGG + Intergenic
955328240 3:58026146-58026168 CTCTTTTCAGGGCTTCTTGGAGG + Intronic
955830694 3:62999897-62999919 CTCTCTGCAGGGCACTTTGATGG - Intergenic
956042208 3:65156343-65156365 TTCTCCACAGGGTTGCTTAAGGG + Intergenic
957715821 3:83928600-83928622 CTCTCTACGGGGAACCTTGATGG + Intergenic
960424714 3:117492415-117492437 TTCTCCACAGGGCAGCTGGAAGG - Intergenic
962055353 3:131865756-131865778 CTCTCTCCAGGTCTGCTTCTTGG - Intronic
962471874 3:135716286-135716308 CTTACCACAGAGCTGCTTGAGGG - Intergenic
962745934 3:138397163-138397185 CTCTCTCTAGGGCTGCTCGAAGG - Intronic
962918253 3:139928141-139928163 CTCTCTCCTGGGCTGGTAGATGG + Intergenic
969498364 4:7539158-7539180 GTCTGTACAGAGCTGCTGGAAGG - Intronic
969994831 4:11301398-11301420 CTCTCTACATGGTTGCCTGCAGG + Intergenic
973023131 4:45228926-45228948 CTTTTTACAGGGCAGTTTGAGGG + Intergenic
975938132 4:79606819-79606841 TTCTCTGCAGTGCTACTTGAAGG + Intergenic
976638521 4:87312435-87312457 CTCTCTAAAGGGCTGCTCTCAGG + Intronic
977061902 4:92270199-92270221 TTCTCTTCAGGGCTCCTTCAGGG + Intergenic
979437938 4:120716664-120716686 CTGTCTATAGTGCTCCTTGAAGG + Intronic
979964483 4:127061534-127061556 CTCTCTAAAGGGCTGCTCCTGGG + Intergenic
987549719 5:19363088-19363110 CTCTGTACAGAACTGCTTCAAGG - Intergenic
992001056 5:72437116-72437138 CTCCCTACAGTGCTTCTTGGAGG + Intergenic
993045364 5:82860298-82860320 CTCTCAACAGGGCACCTTAATGG + Intergenic
994729007 5:103470202-103470224 CTGTCTTCAGGACTGCGTGACGG + Intergenic
995538781 5:113164189-113164211 CTGTCTACAGTGCTGCCTGCAGG + Intronic
996128005 5:119748443-119748465 CTCTCTCTAGGGCTGCTTGATGG + Intergenic
997119107 5:131156194-131156216 CTTTCCAGTGGGCTGCTTGAGGG + Intergenic
997531808 5:134586133-134586155 CAGCCTACATGGCTGCTTGAGGG + Intergenic
1000653690 5:163849854-163849876 GTCTTTACAGGGATGGTTGAAGG + Intergenic
1002073772 5:176696268-176696290 CTCTCTCAAGGGTTTCTTGATGG + Intergenic
1003024541 6:2542533-2542555 CTCTCTCCTGGGCTGGTGGAGGG - Intergenic
1003966599 6:11257734-11257756 CACTCTGCGGGGCTGCTGGAAGG - Intronic
1003973791 6:11323930-11323952 CTCTCTACAGGGCAGCGGGGAGG + Intronic
1006101975 6:31691115-31691137 CTCTTTCCACGGCTGCTTCATGG + Intronic
1006625907 6:35397572-35397594 ATCTCTACAGGACTGCTTCAAGG + Exonic
1009957077 6:70468745-70468767 TTCTCTACTGGGCTCCTAGAAGG - Intronic
1010061457 6:71627205-71627227 CTTTCTTCAGGGATGCCTGATGG + Intergenic
1017879211 6:158548064-158548086 GGCTCCCCAGGGCTGCTTGAGGG + Intronic
1018328839 6:162705757-162705779 CTTCCTACAGGGCTGACTGAGGG - Intronic
1018447834 6:163874522-163874544 CTCTTCACAGGGCTGCAGGATGG + Intergenic
1021822890 7:24515776-24515798 CTCTCCACAGAGCTGTCTGAGGG + Intergenic
1022342168 7:29478944-29478966 CTCTTCACAAGGCTGCTTGGAGG + Intronic
1024250534 7:47502673-47502695 CTCTCCAGCTGGCTGCTTGAGGG - Intronic
1024546653 7:50528166-50528188 CTCTCTCCAGGGCTTCCTGCAGG + Exonic
1026836571 7:73643625-73643647 CTTTCTGCTGGGCTGCTTGGTGG + Intergenic
1028380378 7:90193085-90193107 CTTTCCACTGGGCTGCTTGAGGG + Intronic
1028428891 7:90723446-90723468 CTCTCCACAGGGCTGCCTCATGG + Intronic
1030303954 7:108001722-108001744 CTCTGCACAGGGCTGCGGGAAGG + Exonic
1032481397 7:132249904-132249926 CTCTCTTCAGGGCTGCTACTTGG - Intronic
1033037629 7:137889334-137889356 CTCTCTCCAGCCCTTCTTGAAGG - Intronic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1043592636 8:81848057-81848079 ATCTCCACTGGGCTGTTTGAGGG - Intergenic
1044919474 8:97153570-97153592 CTCTTGACAGGGCTTCTTGATGG - Intergenic
1047609148 8:126504023-126504045 CTCTCTAAAGGGCTGCTCCTGGG - Intergenic
1047766497 8:127994222-127994244 CTCTCTACAGTGCCTCTTGTGGG + Intergenic
1049330395 8:142047397-142047419 CTCGCTCCAGAGCTGCGTGATGG + Intergenic
1049605027 8:143525393-143525415 CCCTCTTCAGGGCTTCTAGATGG - Intronic
1049635004 8:143683393-143683415 CCCACATCAGGGCTGCTTGAGGG + Intergenic
1050625577 9:7500615-7500637 ATCTCTCCAGGGCTGCTTCCTGG + Intergenic
1053611741 9:39720941-39720963 CTCTCAAGAGGGCTGCATGAAGG - Intergenic
1053869777 9:42478943-42478965 CTCTCAAGAGGGCTGCATGAAGG - Intergenic
1054086514 9:60750214-60750236 CTCTCAAGAGGGCTGCATGAAGG + Intergenic
1054555903 9:66655975-66655997 CTCTCAAGAGGGCTGCATGAAGG + Intergenic
1058269151 9:102948053-102948075 CTCTCAACACGGCTGCTTAGGGG + Intergenic
1058359790 9:104131163-104131185 CCCTCTACAGCCTTGCTTGAAGG + Intronic
1058736598 9:107899717-107899739 CTGGCTACAGGGCAGCCTGAGGG + Intergenic
1058875597 9:109242109-109242131 ATTACTACAGGGCTGCTTGGAGG + Intronic
1061998824 9:134205502-134205524 AGCTCTGCAGGGATGCTTGATGG + Intergenic
1189578609 X:42382264-42382286 CTCTCACCAGGACTGCTTGTTGG + Intergenic
1191179257 X:57541499-57541521 CTTTCTACTGAGCTGCCTGAAGG - Intergenic
1198230232 X:134682359-134682381 CTCTTCACAGGGCAGCTGGATGG + Intronic
1198566562 X:137911131-137911153 CCCTCTACAGGATTGCTTGGTGG + Intergenic