ID: 1181770771

View in Genome Browser
Species Human (GRCh38)
Location 22:25123742-25123764
Sequence CTCATGAGATACCCTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 2, 1: 6, 2: 14, 3: 38, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181770765_1181770771 25 Left 1181770765 22:25123694-25123716 CCAGCCTGCAGGTGAAACTGCAC 0: 1
1: 1
2: 1
3: 12
4: 166
Right 1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG 0: 2
1: 6
2: 14
3: 38
4: 179
1181770766_1181770771 21 Left 1181770766 22:25123698-25123720 CCTGCAGGTGAAACTGCACCTCT 0: 1
1: 0
2: 2
3: 25
4: 258
Right 1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG 0: 2
1: 6
2: 14
3: 38
4: 179
1181770769_1181770771 -4 Left 1181770769 22:25123723-25123745 CCAACAGCTTGACTCCAAACTCA 0: 1
1: 0
2: 11
3: 80
4: 362
Right 1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG 0: 2
1: 6
2: 14
3: 38
4: 179
1181770768_1181770771 3 Left 1181770768 22:25123716-25123738 CCTCTGGCCAACAGCTTGACTCC 0: 1
1: 1
2: 2
3: 9
4: 145
Right 1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG 0: 2
1: 6
2: 14
3: 38
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181770771 Original CRISPR CTCATGAGATACCCTGAGCC AGG Intronic
900406291 1:2494567-2494589 CACATGAGAGACGCTGAGGCAGG + Intronic
901009284 1:6190112-6190134 GTCAGGAGATACCCTCACCCTGG + Intronic
901910783 1:12456120-12456142 CCCATGACTTACCATGAGCCAGG - Exonic
903042281 1:20540364-20540386 CTCCTGAAAGACACTGAGCCAGG - Intergenic
903302533 1:22389654-22389676 CTCCTGAGAAACTCTGTGCCAGG - Intergenic
905349622 1:37336276-37336298 CCTGTGAGAGACCCTGAGCCAGG - Intergenic
906328990 1:44868739-44868761 CTCATGAGTTACCTGGAACCAGG + Intronic
907498200 1:54859287-54859309 AGCATGAGAGTCCCTGAGCCAGG + Intronic
910725972 1:90339357-90339379 CTCACGAGAGACTCTGAACCAGG + Intergenic
911701589 1:100959417-100959439 CTTGTGAGAGATCCTGAGCCAGG - Intronic
912982760 1:114391885-114391907 CTCATGAGAAACCCTTGGGCTGG - Intergenic
916053185 1:161050086-161050108 CTCATGAGAAGTCCTGAGGCAGG - Intronic
916369672 1:164076912-164076934 CCCCTGAAATAACCTGAGCCTGG + Intergenic
920292393 1:204932942-204932964 CACATGTGATCCCCTGTGCCTGG - Intronic
921445806 1:215245882-215245904 CACATGAAAGACCCTAAGCCAGG - Intergenic
923136656 1:231125835-231125857 CTCATTAGATACTCTGAGAAAGG + Intergenic
1062774139 10:131372-131394 CTGAAGAGATGCCCGGAGCCTGG + Intergenic
1063543470 10:6957574-6957596 CTCATGAGATCCCCCAACCCTGG - Intergenic
1070731024 10:78828350-78828372 CTCAGGAGTTCCCCTGAGCAGGG - Intergenic
1072918383 10:99554810-99554832 CCCATGAGTTTCCCTGATCCAGG - Intergenic
1073958778 10:108902320-108902342 ATCATGAGAGAGCCTGAGCCAGG - Intergenic
1075478539 10:122757906-122757928 CTCATGAAAGACCCTGAGCCAGG - Intergenic
1075748248 10:124743244-124743266 CCCAAGAGAAACCCTGAGCGGGG + Intronic
1075932718 10:126313072-126313094 CTCATGAGAGACCCTCAGGCTGG - Intronic
1076630009 10:131846752-131846774 CTCAGGTGACACTCTGAGCCGGG + Intergenic
1076732909 10:132447188-132447210 CCCATGGGAGCCCCTGAGCCCGG + Intronic
1079983844 11:27179572-27179594 CTCCAGAGGTACCCTGAGGCAGG - Intergenic
1080649476 11:34210689-34210711 GCCATGAGCTTCCCTGAGCCGGG - Intronic
1081538633 11:44014245-44014267 CTCCTGTGAAGCCCTGAGCCAGG - Intergenic
1081827485 11:46070899-46070921 CCCATGAGATACCCTGTCACAGG - Intronic
1082832667 11:57630627-57630649 CTCATGAGAGACCATGATCAGGG + Intergenic
1084435771 11:69138467-69138489 CTCATGAGAGACCCAGAGCCAGG - Intergenic
1084514420 11:69628568-69628590 CCTGTGAGAGACCCTGAGCCAGG - Intergenic
1085316570 11:75548660-75548682 CTCAAGAGAGACCCTGACCTGGG + Intergenic
1085412232 11:76298135-76298157 CTCCTGGGATCCCCTGACCCAGG + Intergenic
1090923966 11:131233417-131233439 TTTCTCAGATACCCTGAGCCAGG - Intergenic
1091940029 12:4471008-4471030 CTTATGAGAAACCATGAGCCAGG + Intergenic
1092625231 12:10319774-10319796 CTCATGAGAGACCCTGAGCTAGG + Intergenic
1095457756 12:42407245-42407267 TTCTTGAGATATCCTGAGCCAGG - Intronic
1096202227 12:49692920-49692942 CTCCTGGGATACCCTTTGCCTGG - Intronic
1098273722 12:68793197-68793219 CTCCTGAGCTATCCTCAGCCAGG + Intronic
1099014928 12:77332892-77332914 CTCTTGGGAGCCCCTGAGCCAGG + Intergenic
1101652405 12:106689502-106689524 CTCATGAGATCCCATGAAGCAGG + Intronic
1102103193 12:110297470-110297492 CTTATGTGTTACACTGAGCCAGG + Intronic
1104553902 12:129782480-129782502 CTCATGATATCCCATAAGCCAGG - Intronic
1104628948 12:130383222-130383244 CTCATGAAATAGCCTCACCCTGG - Intergenic
1105379053 13:19869990-19870012 CTCATGAGAGACCCTGAGTCAGG - Intergenic
1105392359 13:19992323-19992345 CTCAAGAGATCCCCTGAACTCGG - Intronic
1106896067 13:34303263-34303285 CTCAGGACATGCCCAGAGCCTGG + Intergenic
1108711334 13:53035360-53035382 TACATGAGATACCCTGAGACAGG + Intronic
1109810728 13:67509492-67509514 CTCATGAGAGACCCTCTGCTAGG + Intergenic
1109985129 13:69970842-69970864 CTCATGTGAGAGCCTGAGCCTGG - Intronic
1110647639 13:77906727-77906749 TTCTTGAGAGACCCTAAGCCAGG + Intronic
1111091622 13:83453663-83453685 ATCTCGAGGTACCCTGAGCCAGG + Intergenic
1114456414 14:22857257-22857279 CTAATGAGAGATCCTAAGCCAGG + Intergenic
1114533773 14:23410667-23410689 CTCATGTTAGACCCTGAGCCGGG - Intergenic
1114620879 14:24095267-24095289 CACAAGAGATAACGTGAGCCAGG + Intronic
1114659108 14:24333720-24333742 CTCGGGAGATTCCCGGAGCCGGG + Intronic
1114783004 14:25560545-25560567 CTGATGAGATACCCTGAGCTGGG + Intergenic
1115776078 14:36716730-36716752 CTCATGAGCTAATCAGAGCCAGG - Intronic
1116148767 14:41110483-41110505 CTTAAAAGCTACCCTGAGCCGGG + Intergenic
1116905368 14:50398013-50398035 CTTGTGAGAGACCTTGAGCCAGG + Intronic
1122778761 14:104134873-104134895 CTCATCCAAGACCCTGAGCCTGG - Intergenic
1123070066 14:105638328-105638350 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123074658 14:105661990-105662012 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123089305 14:105735115-105735137 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123095092 14:105763272-105763294 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1124412347 15:29446847-29446869 CTCAAGAGATACCATGCTCCTGG - Intronic
1126174710 15:45724770-45724792 CTTGTGAGAAACCCTGAGCTAGG + Intergenic
1127496852 15:59520938-59520960 CTGAAAAGATACCCTGAGCAGGG - Intronic
1129240836 15:74251256-74251278 GTCATGGGACACCCTGGGCCTGG - Intronic
1129415957 15:75380120-75380142 CTCATTAGAGACTCTGTGCCAGG - Intronic
1131232456 15:90669562-90669584 CTCATGAGATCCTCTGGGCTTGG + Intergenic
1131945123 15:97610993-97611015 CTCCTGAGCTACCTGGAGCCGGG - Intergenic
1133452353 16:5914346-5914368 CTCATGAGAGATCCTGCACCAGG - Intergenic
1133565276 16:6987393-6987415 CTCGGGAGATAACCTGGGCCTGG - Intronic
1134210331 16:12271217-12271239 CTTAGGGGAGACCCTGAGCCAGG - Intronic
1135927172 16:26705686-26705708 TTCATCAGAAACCATGAGCCTGG + Intergenic
1138536444 16:57662858-57662880 CCCATGAGAGCCCCTGGGCCTGG - Intronic
1138771316 16:59667329-59667351 CTCAGGTGATACCCTGATCTCGG + Intergenic
1139424312 16:66869713-66869735 CACATGGGGTACCCTGTGCCAGG + Intronic
1141408656 16:83816784-83816806 TTCATGAGACCACCTGAGCCTGG + Exonic
1142971749 17:3616492-3616514 CTCACGAGAGACCTTGAGCCAGG + Intronic
1144703116 17:17351361-17351383 CTCCTGAGAAACACTGAGCAAGG - Intergenic
1146915315 17:36674557-36674579 CTCAGGAGAGATCCTGAGTCAGG + Intergenic
1151228587 17:72665280-72665302 CTCATGAGAGACCCTGAGCCAGG + Intronic
1151246008 17:72795212-72795234 CTCATGACAGACCCCGAGCCAGG - Intronic
1152642336 17:81454465-81454487 CTCCTGAGAGGGCCTGAGCCCGG + Intronic
1152878922 17:82804375-82804397 CTCAGGAGAGACCCTGACCAGGG - Intronic
1153839869 18:8997043-8997065 CTCATGAGAAACCCTCAGCTAGG + Intergenic
1155163200 18:23212005-23212027 CTCATCAGATACCACGGGCCCGG - Intronic
1156196100 18:34775789-34775811 ATCTTGTGATACCCTGAGCAGGG + Intronic
1157403787 18:47407122-47407144 CTCATGAGAGACCCTGAGCCAGG + Intergenic
1157479791 18:48046059-48046081 CTCATGAAAGACACTGAACCAGG + Intronic
1158582308 18:58694746-58694768 CTCACGAGAGACCCTCAGCCAGG - Intronic
1159899660 18:74034110-74034132 CATATGAGAGACCCTGGGCCAGG + Intergenic
1161330085 19:3682802-3682824 CTCATGAGAGACCCCGAGCCAGG + Intronic
1161380672 19:3963568-3963590 CACATGAGACACACGGAGCCGGG + Intronic
1163773897 19:19206781-19206803 TTGATGGGATTCCCTGAGCCTGG + Intergenic
1164647056 19:29866248-29866270 CTCCTGAGAAACCTTGAGCTGGG + Intergenic
1165792374 19:38500012-38500034 TGCATGTGAGACCCTGAGCCAGG + Exonic
1166234442 19:41445615-41445637 CTCATTAGCTAACCTGAGCCAGG + Intergenic
1167484962 19:49757323-49757345 CTCGTGAGACGCCCTGAGCCAGG + Intronic
1168243476 19:55098609-55098631 CTCAGGAGAGACCCCCAGCCGGG - Intronic
924998975 2:388587-388609 CTCTTGACATACCAAGAGCCAGG - Intergenic
925907922 2:8550521-8550543 CTTGTGAGATGCCCGGAGCCAGG - Intergenic
929504977 2:42521374-42521396 CTTGTGAGAGACCCTGAGCCAGG + Intronic
931318132 2:61151479-61151501 CTCTAGAAAGACCCTGAGCCAGG - Intronic
933766635 2:85713681-85713703 TTGATGAGAAATCCTGAGCCAGG + Intergenic
936151199 2:110023294-110023316 CTCCTCAGAGACCCTGAGGCTGG + Intergenic
936193476 2:110348075-110348097 CTCCTCAGAGACCCTGAGGCTGG - Intergenic
937238445 2:120444763-120444785 CCCATGAGAGACCCCGAGCCAGG - Intergenic
937980326 2:127611017-127611039 CTCATGAGGGACCCTGAACTGGG - Intronic
938192927 2:129299776-129299798 TTCATGACATGCCCAGAGCCTGG - Intergenic
938390467 2:130901254-130901276 CTGCTGACATAGCCTGAGCCTGG + Intronic
939182659 2:138822343-138822365 CTGTTGAGTTACCCTGAGGCTGG - Intergenic
939789593 2:146555330-146555352 CTCATGAGATACCCTGAGCCAGG + Intergenic
940197221 2:151108329-151108351 CTCACTAGAGACCCTGAGTCTGG - Intergenic
943082673 2:183275438-183275460 CCCATGAGATAGCCTCATCCTGG + Intergenic
943333070 2:186584034-186584056 CTCAAGTGAGACCCTGAGCCAGG - Intergenic
943346247 2:186740640-186740662 ATAATGAAATACCCTGAGCCGGG + Intronic
945560667 2:211336041-211336063 TTCATGAGAGACCCTGAGCTAGG - Intergenic
946213941 2:218169013-218169035 CTCAAGAAAGACCCTGAGGCCGG + Intergenic
946841938 2:223828191-223828213 TTCATGAGATCACCTGAGCGTGG - Intronic
948569335 2:238907444-238907466 CTCAGGCGCTACCCAGAGCCTGG - Intronic
1169893875 20:10481764-10481786 CTTGTGAGAGACCCTGAGCAAGG - Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1170897972 20:20433448-20433470 CTCTGGAGATATCCTGTGCCTGG - Intronic
1173270110 20:41526261-41526283 CTCAGTAGAGACCCTGAGCTTGG - Intronic
1173289168 20:41699350-41699372 CTCATGAGAGACCATGAGCCAGG + Intergenic
1173768144 20:45632333-45632355 AGCCTGAGATACCCAGAGCCCGG - Intergenic
1174828684 20:53792994-53793016 CTCATGAGGTCTCCTGAGGCTGG - Intergenic
1175235499 20:57507728-57507750 CTCAGGAGTGGCCCTGAGCCAGG + Intronic
1175386918 20:58603101-58603123 CTCATGAGAGACCCCAAGCCGGG - Intergenic
1177911143 21:27033828-27033850 CTTCTGAAAGACCCTGAGCCAGG + Intergenic
1179806986 21:43845620-43845642 CTCACAAGAGACCCTGAGCCAGG + Intergenic
1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG + Intronic
1181919964 22:26312889-26312911 CTGCTGAGCCACCCTGAGCCTGG + Intronic
1181982892 22:26778622-26778644 CTCATGAGCAACCCAGATCCAGG + Intergenic
1182711939 22:32328652-32328674 CTCCTGAGAGACCCCAAGCCAGG + Intergenic
1184693009 22:46125852-46125874 CTCAGGCGATACTCTGAGACAGG - Intergenic
1184867097 22:47207652-47207674 CTCTGGAGAGACCCTGAGCCAGG + Intergenic
1184987523 22:48145741-48145763 CCCATGAGGAACACTGAGCCTGG - Intergenic
956769482 3:72512525-72512547 CTCATGAGAGACCCTGAGCCGGG + Intergenic
959002207 3:100977383-100977405 CTCATGAGAGATTCTGAGCCAGG - Intronic
961579844 3:127871619-127871641 CTCATAAGAAACCCTAAGCAAGG + Intergenic
963462931 3:145639983-145640005 CTCCTGAGTTGCTCTGAGCCGGG + Intergenic
964647287 3:158971733-158971755 CTCATGAAATAACCTGTGCCTGG - Intronic
964961573 3:162434467-162434489 CTCAACAGATACCTAGAGCCAGG - Intergenic
967222082 3:187255916-187255938 CTCAGAAGAGACCCTGAGCTGGG - Intronic
970000798 4:11364269-11364291 ATCATGAGAGATCCTGACCCTGG + Intergenic
971223815 4:24733164-24733186 CTCATCAGATCCCTTGAGGCAGG + Intergenic
972731584 4:41800211-41800233 CTCATAAGAGACCTTGAGCCAGG - Intergenic
973159057 4:46993467-46993489 CTCTTCAGATGCCCTGAGCAGGG + Exonic
973730117 4:53815119-53815141 CTGGTGAGAAACCCTGAGCCAGG - Intronic
975709987 4:77151403-77151425 TTCATAAGAAACCCTGAGCAAGG + Intergenic
976120019 4:81769723-81769745 CTCATGAGTTTCCCTTAGGCTGG + Intronic
976426342 4:84907572-84907594 CTTATGAGAAATCCTAAGCCAGG + Intronic
976912678 4:90326805-90326827 CTCATCCAATACCCTGGGCCAGG - Intronic
979216392 4:118169829-118169851 CTCATGAGAAACCTGGAGCCAGG - Intronic
982711405 4:158761803-158761825 CTGAGGAGATACCATGTGCCAGG + Intergenic
983147364 4:164233527-164233549 CTCATGACATACCATTATCCTGG + Intronic
984248910 4:177308373-177308395 CTCTTGAGAAATGCTGAGCCAGG + Intergenic
986689963 5:10306338-10306360 CTCCTGGGAGAGCCTGAGCCCGG + Intronic
986791277 5:11163395-11163417 CTCATGACAGACCCTGAGCCAGG + Intronic
988627200 5:32890055-32890077 CTCAAGAGAGACCCTGAGCCTGG + Intergenic
988806288 5:34743706-34743728 CAATTGAGATACCCTGGGCCTGG + Intronic
989940661 5:50146136-50146158 CTCAAGTGATTCCCTGACCCTGG + Intergenic
991029153 5:62064894-62064916 CTCCTTAGATACCCTCTGCCTGG + Intergenic
993201751 5:84825646-84825668 CTCATGAGAAACCTTAAGCCAGG - Intergenic
996372940 5:122772535-122772557 CTTCTGAGAGACCCTGAGTCAGG + Intergenic
997882744 5:137604868-137604890 GTCAAGGGATACCCAGAGCCCGG + Intergenic
999523716 5:152380114-152380136 CTCGTGAAAGACCCAGAGCCAGG - Intergenic
999730636 5:154474567-154474589 CTCCTGAGCTACCCTGCCCCAGG + Intergenic
1001573432 5:172745930-172745952 CAAATGAGATATCCTAAGCCAGG + Intergenic
1002378269 5:178804575-178804597 GACATGAGAAACACTGAGCCTGG + Intergenic
1003816528 6:9847597-9847619 TTCATGAGAGACCCTGAGCCAGG - Intronic
1003874617 6:10424672-10424694 CTAATGGGATATCCTGAGTCAGG + Intergenic
1006677488 6:35774890-35774912 CTCACGAGATCCTCTCAGCCGGG + Intergenic
1007305670 6:40902327-40902349 CTCATGCCAAGCCCTGAGCCAGG + Intergenic
1007645464 6:43376967-43376989 TTCTTGAGAGACCCTGAGCCAGG + Intergenic
1007674545 6:43582214-43582236 CTGATGAGTTACCATGAGCATGG - Intronic
1007756634 6:44103764-44103786 CTGAGGAGATGCCCAGAGCCTGG - Intergenic
1007756724 6:44104287-44104309 CTGATGAGACACCCTGAGCAGGG + Intergenic
1008170119 6:48194782-48194804 TTGATGAAATACGCTGAGCCTGG - Intergenic
1011047012 6:83095726-83095748 TTCATGAGTTACCCGAAGCCAGG - Intronic
1014978997 6:127924130-127924152 CACATGAAAGACCCTGAGCCAGG + Intergenic
1016892823 6:149023456-149023478 CTCATGAGAGATCCCAAGCCAGG + Intronic
1017029926 6:150211998-150212020 GTGATGAGAAACCCTGAGCTTGG - Intronic
1017145063 6:151227358-151227380 CTCATGAGAGTCCCTGAGTCAGG - Intergenic
1019441831 7:1051338-1051360 CTGCTGGGAGACCCTGAGCCAGG + Intronic
1020270477 7:6591874-6591896 CTCAAGAGAGACCCTCGGCCGGG + Intronic
1021871321 7:25009121-25009143 CCCATGAGAGACTTTGAGCCAGG - Intergenic
1022243191 7:28532304-28532326 CTCATAAGAGTGCCTGAGCCAGG + Intronic
1023304816 7:38814991-38815013 CTCATGAGCAACCTTCAGCCAGG + Intronic
1023801830 7:43841605-43841627 CTCAAGAGATCCCCTGACCTTGG + Intergenic
1027184984 7:75965677-75965699 CTCAGCAGTGACCCTGAGCCAGG - Intronic
1028469793 7:91192914-91192936 TTCATCAGATAGCCTGATCCGGG + Intronic
1029572174 7:101377301-101377323 CTCATCAGAAATCCTCAGCCGGG - Intronic
1031823751 7:126535942-126535964 CTCATGAGAGACCCTGAGCCAGG + Intronic
1032084517 7:128877037-128877059 CCCAGGAGACACCCTGAGCCAGG - Exonic
1033818701 7:145107308-145107330 CTTTTGAGATACCTTGAGGCAGG + Intergenic
1034931053 7:155164465-155164487 CTCATGAGAGACCCTGAGCCAGG - Intergenic
1036673705 8:10811584-10811606 CGCGTGAGAGACCCTGAGCCAGG - Intronic
1037556102 8:20024075-20024097 CTCATAAGATACCCTGAGCCAGG + Intergenic
1038490962 8:27970766-27970788 CTCTTGAGAAAGCCTGAGCCAGG + Intronic
1040784878 8:51154206-51154228 CACCTGTGATACCCTGAGCAGGG - Intergenic
1040918055 8:52584195-52584217 CTGATAAGATGCCCTGAGCTGGG - Intergenic
1041653289 8:60322493-60322515 TTGGTGAGAGACCCTGAGCCAGG - Intergenic
1044962848 8:97547954-97547976 CTCATGAGAAATCCTGAGCCAGG - Intergenic
1047175912 8:122540147-122540169 CTCAGGAGAGACCCTGAGCCAGG + Intergenic
1047697126 8:127415110-127415132 CTCATGAAATACCCTTATCCAGG + Intronic
1047876010 8:129138334-129138356 CCCTTGAGAAAGCCTGAGCCAGG - Intergenic
1048045259 8:130766966-130766988 ATGAAGAGATACCCTGAGACTGG + Intergenic
1048898320 8:139015011-139015033 CTCACGAGAGACTCTGAACCAGG - Intergenic
1048950181 8:139490093-139490115 CTCATGTGAAACCCTCAGACTGG - Intergenic
1050157899 9:2687035-2687057 CTCATGAGCTTCTCTGGGCCTGG - Intergenic
1050842169 9:10164843-10164865 CTAATGAGATATGCTGAGCTTGG + Intronic
1051984328 9:23064287-23064309 CACCTGAGATAACCTCAGCCTGG + Intergenic
1055480172 9:76701907-76701929 CGCATGAGAAAACCTAAGCCTGG + Intronic
1057098852 9:92338754-92338776 CTCATGAGAGGCCCTGAGCAAGG - Intronic
1057317189 9:93977088-93977110 CACCTGAGATCCCCTCAGCCTGG - Intergenic
1058113983 9:101064312-101064334 CCCATGAGAAACTCTGAGCCAGG - Intronic
1058765918 9:108182623-108182645 TTCATCAGAAACCCTGACCCTGG + Intergenic
1059489511 9:114655591-114655613 CTCAAGTGAAAACCTGAGCCAGG - Intergenic
1060864190 9:126981873-126981895 CTCCTGAGAGACCCTGAGCCAGG - Intronic
1187449616 X:19385167-19385189 TTCCTGGGAGACCCTGAGCCAGG - Intronic
1187809688 X:23161778-23161800 CTCATGAGAGACCTTGAATCAGG - Intergenic
1188527296 X:31100031-31100053 CTCCAAAGATGCCCTGAGCCTGG + Intronic
1189127952 X:38467935-38467957 CACATGAGAGACTCTGTGCCAGG + Intronic
1189350951 X:40275334-40275356 CTCATGAGACACCCCAAGCCAGG - Intergenic
1190237292 X:48626256-48626278 TTCATGAGAGACCCTGAGCCAGG - Intergenic
1190759707 X:53429314-53429336 CTCATGCCATGCCCTCAGCCTGG + Intronic
1192437522 X:71152123-71152145 GACATCAGATACCCTCAGCCTGG - Intronic
1194539849 X:95156734-95156756 CTGATGAGAGGTCCTGAGCCAGG - Intergenic
1196068697 X:111495241-111495263 ATTATGAGATTCCCTCAGCCTGG + Intergenic
1197761631 X:130032208-130032230 CTCACGAGAGACCCCAAGCCAGG - Intronic
1198097877 X:133398422-133398444 CTAATGAGGAACCCTGAGGCTGG - Intronic
1198338783 X:135693523-135693545 CGCATGCTGTACCCTGAGCCAGG - Intergenic