ID: 1181772924

View in Genome Browser
Species Human (GRCh38)
Location 22:25139760-25139782
Sequence TCTATGTTCCCTCCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181772924_1181772927 20 Left 1181772924 22:25139760-25139782 CCTCTTTGAGGAGGGAACATAGA 0: 1
1: 0
2: 2
3: 24
4: 219
Right 1181772927 22:25139803-25139825 CCAGAGCTCTGCAGATATCTAGG 0: 1
1: 0
2: 3
3: 13
4: 235
1181772924_1181772928 26 Left 1181772924 22:25139760-25139782 CCTCTTTGAGGAGGGAACATAGA 0: 1
1: 0
2: 2
3: 24
4: 219
Right 1181772928 22:25139809-25139831 CTCTGCAGATATCTAGGAAAAGG 0: 1
1: 0
2: 4
3: 30
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181772924 Original CRISPR TCTATGTTCCCTCCTCAAAG AGG (reversed) Intronic
903002962 1:20279455-20279477 TAAATGTTACCTCCTCACAGAGG - Intergenic
905181831 1:36172031-36172053 CCTCTGTTTCCTCCTCAAAATGG - Intronic
907907860 1:58800643-58800665 TCTACATCCCCTCCTCAGAGAGG - Intergenic
907976447 1:59435633-59435655 TCAATGTCACCTCCTCAGAGTGG + Intronic
908545892 1:65161892-65161914 TAAATATTACCTCCTCAAAGAGG - Intronic
910812706 1:91254132-91254154 TTTATGTTTCCTCCTCAACTTGG - Intergenic
911230815 1:95359813-95359835 TAAATGTTACCTCCTCAATGAGG - Intergenic
912171110 1:107100698-107100720 TCTATGTAAGCTCCTCAAAAAGG + Intergenic
914420232 1:147522246-147522268 TCCATGTTCCCTCCCAAAAAAGG - Intergenic
915081989 1:153358856-153358878 CAAATGTTACCTCCTCAAAGAGG - Intronic
915796907 1:158745131-158745153 CCTGTGTTCCCTCCTTAAAAGGG + Intergenic
916700176 1:167284684-167284706 TATATTTTTCCTCTTCAAAGGGG + Intronic
917960864 1:180143311-180143333 TCTAAGTGAACTCCTCAAAGGGG - Intergenic
920135833 1:203768631-203768653 TCTATAGTCCTTCCTCAGAGAGG - Intronic
920363264 1:205433974-205433996 TCTCTGTTCCCCCATCCAAGTGG + Intronic
921311473 1:213848097-213848119 TCTGTATTCCCTCCTTAATGAGG - Intergenic
923309172 1:232718767-232718789 TCTGTGTTCCCTCCTCAACACGG + Intergenic
924042381 1:239997249-239997271 ACTATGTTCTCTGCTAAAAGTGG - Intergenic
924137916 1:240989964-240989986 GCTATTTTCCATCCACAAAGTGG + Intronic
1064065109 10:12174947-12174969 TCTCTGTTCACTCCTCACAGTGG - Intronic
1064356434 10:14622937-14622959 TCTAGTTTGCCTCTTCAAAGGGG + Intronic
1070259396 10:74839807-74839829 TCTGTGTTCTATCCTGAAAGTGG + Intronic
1071952235 10:90717052-90717074 TCTATGTAACCTCCTCACTGAGG + Intergenic
1073035871 10:100563866-100563888 TCTAGCTTCCCTCCTTCAAGGGG - Intergenic
1074693012 10:116023961-116023983 TCTGTCCTCCTTCCTCAAAGGGG + Intergenic
1075989372 10:126821805-126821827 TCAATCTACCCTCCTGAAAGAGG + Intergenic
1077634461 11:3832754-3832776 TCTATATGCCCTCCTGAAATGGG - Intronic
1079022674 11:16922786-16922808 TCTCTCTTCCCTCTTAAAAGAGG - Intronic
1079476669 11:20837904-20837926 TCAATATTCCATCCTCAAGGAGG + Intronic
1080113422 11:28595393-28595415 TCTATGTTTTCTCCTCAAGTGGG + Intergenic
1080196128 11:29611591-29611613 ACTAGGTTCCTTCCCCAAAGGGG + Intergenic
1080785461 11:35471160-35471182 TAAATATTCTCTCCTCAAAGAGG + Intronic
1083954088 11:65973425-65973447 TCTGTGATCCCTCCTGAAACTGG - Intronic
1084090223 11:66874877-66874899 TCTGTGTCCCCTCCTCAGAGAGG - Intronic
1085521305 11:77140461-77140483 TCCAATTTCTCTCCTCAAAGAGG - Intronic
1086569076 11:88262582-88262604 TTTATGTTCCTTCCCCAAGGTGG + Intergenic
1087882152 11:103429324-103429346 TATGTTTTCCCTTCTCAAAGAGG - Intronic
1088096209 11:106104077-106104099 TCTGTGTTGCCTTGTCAAAGTGG + Intergenic
1089505119 11:118957474-118957496 CCTATGTGCACTCCTCCAAGAGG - Intronic
1090327047 11:125897715-125897737 TCTCTATTCCCTCTCCAAAGTGG - Intronic
1092090530 12:5800107-5800129 TCAATGTCACCTCCTCAGAGAGG - Intronic
1092129337 12:6097881-6097903 TCTATGTCCCTTCCTTAATGTGG - Intronic
1092496996 12:9006310-9006332 CAAATGTTCCCTCCCCAAAGAGG - Intronic
1093545347 12:20338579-20338601 TACAGGTTACCTCCTCAAAGGGG + Intergenic
1095184400 12:39184947-39184969 CCTTGGTTCCATCCTCAAAGTGG + Intergenic
1095254687 12:40020670-40020692 TTTTTTTTCCCACCTCAAAGGGG - Intronic
1098963995 12:76766600-76766622 TCTATGTTCTCTCCAAAAAGAGG - Intronic
1100149736 12:91722244-91722266 TCTATGTTCCATCCACAAGTGGG + Intergenic
1100550358 12:95641334-95641356 TAAATATTACCTCCTCAAAGAGG + Intergenic
1101242417 12:102851548-102851570 TCTATGATCCCACCTGAAATGGG - Intronic
1101562112 12:105866365-105866387 CCAAGTTTCCCTCCTCAAAGGGG - Intergenic
1102131983 12:110538825-110538847 TCAATGTCACCTCCTCAAAAAGG + Intronic
1106565075 13:30877256-30877278 TCTTTGTTCCCTATTCATAGTGG + Intergenic
1106780756 13:33056963-33056985 CCTAATTTCCCTCCTCAGAGTGG + Intronic
1108408254 13:50125222-50125244 TCTCAGTTCCCTTCTAAAAGTGG + Intronic
1110891647 13:80704701-80704723 TCTCAGTTCCCGCCTCACAGGGG - Intergenic
1111177277 13:84611857-84611879 TTTGTGTTCCCTCCCGAAAGAGG - Intergenic
1111946590 13:94671414-94671436 TACATGTTGCTTCCTCAAAGAGG + Intergenic
1112765081 13:102733118-102733140 TCTAAGTTTCCCCTTCAAAGTGG - Exonic
1115653388 14:35419998-35420020 TAGAAGTTCCCTCCACAAAGTGG + Intergenic
1119899679 14:78249155-78249177 TCCATGTTCCCCCTTCAATGAGG + Intronic
1129612597 15:77072369-77072391 CCAATGTTCTCTCCTCAGAGAGG - Intronic
1129638336 15:77346994-77347016 TAAATGTCCCCTCTTCAAAGAGG - Intronic
1129646334 15:77437101-77437123 TATGTGTTCCTTCTTCAAAGAGG + Intronic
1130844244 15:87729587-87729609 GCTTCCTTCCCTCCTCAAAGGGG + Intergenic
1133300579 16:4779882-4779904 ACCATGTTCCCTCCTCGAAAAGG - Intronic
1136017088 16:27407398-27407420 TCAGTGTTGCCTCTTCAAAGAGG - Intronic
1138006328 16:53341320-53341342 ACTGTGTTCCTCCCTCAAAGTGG + Intergenic
1138267841 16:55672569-55672591 CCTATGTCACCTCCTCAGAGAGG - Intronic
1138591008 16:57999981-58000003 TCTGTGATCACTCCGCAAAGGGG + Intronic
1138962305 16:62041718-62041740 TCTTTTCTCCTTCCTCAAAGGGG + Intergenic
1140692084 16:77494168-77494190 TCTATCTGCCCTCCCAAAAGGGG - Intergenic
1141033554 16:80609750-80609772 CCTAAGTTCTCTCTTCAAAGAGG - Intronic
1143595163 17:7909587-7909609 TCTGTGTCCCCTCCACACAGTGG + Intronic
1143608624 17:8004756-8004778 TCTAAATTCCCTTCTCATAGTGG - Intronic
1144697479 17:17314846-17314868 TGCATGTTGCCTCCTCACAGAGG + Intronic
1146367187 17:32238316-32238338 TAAATGTTACCTCCTCAAAGTGG + Intronic
1146633330 17:34486094-34486116 TCTACGTGCCCTCTTCTAAGTGG - Intergenic
1150187232 17:63196022-63196044 TAAATGTTACCTCCTCAGAGAGG + Intronic
1150437564 17:65165804-65165826 CCAATGTTACTTCCTCAAAGAGG + Intronic
1151652484 17:75478623-75478645 TCTCTGTTCTATCATCAAAGAGG - Intronic
1151871606 17:76840550-76840572 TCAGTGTTACCTCCTCAAAGAGG + Intergenic
1152122174 17:78425589-78425611 TCTATGTCCTCTCCTCCTAGCGG - Intronic
1152131993 17:78483160-78483182 TCCAGGCTCCCTCCTCAGAGTGG + Intronic
1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG + Intronic
1153568451 18:6444415-6444437 TCGATTTTCTCTCTTCAAAGAGG + Intergenic
1155099818 18:22599550-22599572 TTTATGTTTCTTCCTCAGAGAGG + Intergenic
1155400269 18:25431054-25431076 TCTAAGTTCCCTCCCACAAGTGG + Intergenic
1155571986 18:27204784-27204806 TCTTTATTCCCTTCTGAAAGTGG - Intergenic
1156442905 18:37209573-37209595 TAAATGTCACCTCCTCAAAGAGG - Intronic
1156729401 18:40172503-40172525 TCGATGTCCCCTACTCAAAGAGG + Intergenic
1158464072 18:57674336-57674358 ACTGTGTTCCCTACTCAAAGGGG - Intronic
1159607037 18:70485540-70485562 TTTATGTTCCCTCCCCAACTTGG + Intergenic
1159992154 18:74921416-74921438 TCTAAATTTACTCCTCAAAGAGG - Intronic
1161320720 19:3639686-3639708 TCTGTGATCCCTCCTAAAGGAGG - Intronic
1161497070 19:4592481-4592503 TCAATGTCACCTCCTCAGAGAGG - Intergenic
1162476812 19:10905308-10905330 TCTATGTCCCCACCTCCAAGAGG + Intronic
1163934006 19:20424867-20424889 TCTGTGTTCTCTGCTCATAGAGG - Intergenic
1164232893 19:23306716-23306738 TCGCTGTTCCCTTCTCAAATGGG + Intronic
1164304136 19:23988612-23988634 TGAGTGTTCCCTTCTCAAAGGGG - Intergenic
1165037111 19:33041654-33041676 TCCAAGTTCCCTGCTCACAGGGG + Intronic
1165813226 19:38624977-38624999 TAGATGTTCCCTCCTCCAGGAGG - Intronic
1166911632 19:46163284-46163306 TTTATGTTCCTTCCTCAAGTTGG + Intergenic
1167721492 19:51183059-51183081 TCTGTGTTCCTTTCTCAAGGCGG - Intergenic
1167763485 19:51463711-51463733 TCTGTGTTCCTTTCTCAAGGCGG + Intergenic
925627077 2:5852261-5852283 TAAATGTTACCTCCTCAGAGAGG - Intergenic
927721898 2:25388405-25388427 ACTTTCTTCCTTCCTCAAAGAGG - Intronic
928216305 2:29364288-29364310 TCTCTGTCCCCTCCTGGAAGGGG + Intronic
928910051 2:36410886-36410908 CCCAAGTTCCCTCCTCAATGTGG - Intronic
930165765 2:48202405-48202427 CCTATATACCCTCTTCAAAGCGG + Intergenic
930667958 2:54117997-54118019 TCTATGTTCTCACTTCTAAGTGG - Intronic
931046612 2:58361349-58361371 TCTATGTCCCATTCTCATAGTGG + Intergenic
932598008 2:73106337-73106359 TGTATGTCCCCTCCTCACAGAGG + Intronic
933771570 2:85747987-85748009 TCTATGTCCCCTTCTCAGTGAGG - Intergenic
933969661 2:87460173-87460195 TTTCTGTTCCGTCCTCAAACAGG + Intergenic
935291041 2:101611266-101611288 TGTATGTTCCCTCCTCACTCTGG - Intergenic
936324125 2:111490324-111490346 TTTCTGTTCCGTCCTCAAACAGG - Intergenic
936819088 2:116497161-116497183 TCTATATTCTCTTCTCCAAGTGG + Intergenic
939571489 2:143845714-143845736 CAAATGTTACCTCCTCAAAGAGG + Intergenic
939771521 2:146325866-146325888 ACCATGTTGGCTCCTCAAAGTGG - Intergenic
940216398 2:151307907-151307929 TCAATGTCACCTCCTCAGAGAGG + Intergenic
941527777 2:166628231-166628253 TTTCTGTTCCCTCCCCAAATTGG + Intergenic
943201273 2:184828180-184828202 TTTATGTTCCCTTTTCAAAAAGG + Intronic
947074233 2:226324757-226324779 TCTCTGTTCCCCCCTTAAAAGGG - Intergenic
948456145 2:238105546-238105568 CCCAAGTCCCCTCCTCAAAGAGG - Intronic
948511825 2:238472431-238472453 TCTGTGTTCACTGCTGAAAGTGG + Intergenic
948942428 2:241203135-241203157 CATATGTCCCCTCCTCAGAGAGG + Intronic
1168855528 20:1005020-1005042 TCGATGTTGCCTCCTCAGAGAGG + Intergenic
1168866024 20:1087320-1087342 GCACTGTTCCCTCCTCAGAGTGG - Intergenic
1169780547 20:9305401-9305423 TCTCTGTTCCCTTCCCAAAATGG + Intronic
1170369661 20:15635503-15635525 TGTATGTTCTCTCCTATAAGTGG + Intronic
1174309087 20:49636459-49636481 TCTCTGTTCCCTCCCTAAACAGG - Exonic
1174592770 20:51659154-51659176 TCAACTTTACCTCCTCAAAGAGG + Intronic
1175049157 20:56137184-56137206 TTTATGTTAACTCATCAAAGAGG - Intergenic
1175125997 20:56751936-56751958 TCTATGTCGCCTCCTCAGAGAGG - Intergenic
1175345447 20:58269911-58269933 TCTATCTTCCCTATTCAAACAGG + Intergenic
1175772225 20:61631007-61631029 TCAATGTCACCTCCTCAGAGAGG - Intronic
1175854641 20:62113903-62113925 TCTATCTTCCCTCCTGAAAGGGG + Intergenic
1180003774 21:45009484-45009506 TCAATGTTCCCTCTTCCATGTGG + Intergenic
1180073902 21:45452069-45452091 TCTCTGCTCCCTCCACCAAGGGG + Intronic
1181772924 22:25139760-25139782 TCTATGTTCCCTCCTCAAAGAGG - Intronic
1183085045 22:35481512-35481534 TAAATGTTACCTCCTCAGAGAGG + Intergenic
1183624961 22:38996273-38996295 TTTCTGCTCCCTCCTGAAAGAGG + Intergenic
1184131418 22:42518991-42519013 TTAATGTTGCTTCCTCAAAGAGG - Intronic
1184141644 22:42581207-42581229 TTAATGTTGCTTCCTCAAAGAGG - Intergenic
1184263098 22:43330701-43330723 TTTATTTTTCCTCCTAAAAGTGG + Intronic
949735197 3:7163658-7163680 TAAATATCCCCTCCTCAAAGAGG - Intronic
951896127 3:27611352-27611374 TGTATGTTCTCTCCTTAGAGCGG - Intergenic
952002081 3:28797747-28797769 TCTAGTTTCCCACCTCAAACTGG + Intergenic
953070211 3:39512937-39512959 GATTTGTTCCCTCATCAAAGTGG + Intronic
954697390 3:52435098-52435120 TCTGTGTTCCCTCCCCAAGTCGG + Exonic
954830924 3:53420749-53420771 CCTATGTTTCCTCCACAAATGGG - Intergenic
955641219 3:61087101-61087123 TCAATGTCACCTCTTCAAAGAGG + Intronic
955888019 3:63620949-63620971 TACATGTTCCCTCCTCAGAGAGG - Intergenic
956189109 3:66591608-66591630 TCTTTCTTCCCTGGTCAAAGTGG - Intergenic
956196613 3:66659264-66659286 TCTTTGTTCCTTTCTGAAAGAGG - Intergenic
956671280 3:71693375-71693397 TCTCTGTCCCCTGCTCAAAGAGG - Intronic
957414074 3:79878303-79878325 TCTATGCTCCCTCCCACAAGGGG - Intergenic
959585761 3:108023683-108023705 TCACTGTTCCCTCCTCAATCTGG + Intergenic
960951069 3:122998725-122998747 TCTTTGTTCCCTCTTCCCAGGGG + Intronic
968854681 4:3110879-3110901 TCTGTGTTCTCTCCTGAAATTGG + Intronic
969601898 4:8181785-8181807 TCCCTGTTCCCTGCTCAGAGAGG - Intergenic
969603276 4:8189419-8189441 GGTGTGTTGCCTCCTCAAAGAGG - Intronic
970503189 4:16699784-16699806 TCTGTGTTCCCTACTCAGAGAGG - Intronic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
972974713 4:44619953-44619975 TATATGTTACCTCCTGAGAGAGG - Intergenic
973637767 4:52875768-52875790 TCTATGTTACTTCTTGAAAGAGG + Intronic
974094676 4:57350728-57350750 TTTATGTTCCCTCTTCAACTTGG + Intergenic
974975591 4:68887467-68887489 TATATTTTGCCCCCTCAAAGAGG + Intergenic
977135468 4:93298429-93298451 TCTATGGTCCCTTTTAAAAGAGG + Intronic
978106488 4:104907736-104907758 CATATGTTACCTCCTCACAGAGG + Intergenic
978952882 4:114582351-114582373 TATATGTTCCTTCCTCAACTTGG + Intergenic
979745326 4:124205877-124205899 TTTATGTTCCCTCCCCAACTTGG + Intergenic
981593126 4:146387539-146387561 GCTATGTTCCCTGGTAAAAGTGG - Intronic
981691832 4:147517420-147517442 TCCATGTGGCTTCCTCAAAGAGG - Intronic
984229959 4:177083454-177083476 TTAATGTTACTTCCTCAAAGAGG + Intergenic
984457764 4:179992657-179992679 TGTATGTTCCCACTTGAAAGTGG + Intergenic
985826234 5:2193570-2193592 TCTGTGTTCCCTTCTCACTGTGG + Intergenic
990024378 5:51167505-51167527 TCTAGGTACCCTCATAAAAGTGG + Intergenic
990176825 5:53117013-53117035 TATATTTTCCCTCCTTAAACTGG - Intergenic
990409513 5:55527179-55527201 TCTGGGTCCCTTCCTCAAAGGGG - Intronic
991145248 5:63295297-63295319 TGAATGTTCCCTCCTCTAAGTGG - Intergenic
991982499 5:72247495-72247517 TCTCTGTTGCCTGCCCAAAGTGG - Intronic
996281967 5:121740921-121740943 TCCATGTTACCTCCTCAGAGAGG - Intergenic
996422328 5:123276593-123276615 TCTGGTTTCCCTCTTCAAAGTGG - Intergenic
998506099 5:142674105-142674127 TCTATGTCACCTGCTCAGAGAGG + Intronic
999504943 5:152184937-152184959 TCTAAGATCACTCTTCAAAGTGG - Intergenic
1001250393 5:170142600-170142622 TAAATGTTTCTTCCTCAAAGGGG - Intergenic
1006499791 6:34450843-34450865 TCTAAGTTCTCTCATCAATGTGG + Intergenic
1007094905 6:39207163-39207185 TGAATGTCCCCTCCTGAAAGAGG + Intronic
1007101536 6:39250922-39250944 TCAATGTTACATCCTCAGAGAGG + Intergenic
1008246565 6:49181964-49181986 TCTATGTGCCTTGCTCAAAACGG - Intergenic
1009394017 6:63176498-63176520 TCTAAGTTACAGCCTCAAAGCGG - Intergenic
1009551776 6:65105777-65105799 TTCATGTTGTCTCCTCAAAGAGG - Intronic
1009567225 6:65324449-65324471 TGTATGTTCCTTCCTTCAAGTGG - Intronic
1010609459 6:77935798-77935820 TCTATATTTTCTCCTCAAAATGG + Intergenic
1012001400 6:93659520-93659542 TCTAGGGTCTTTCCTCAAAGAGG - Intergenic
1015411158 6:132895290-132895312 CCTATGTCCCCTCCTCCAAAGGG - Intergenic
1015943359 6:138474396-138474418 TCCATGATTCTTCCTCAAAGAGG + Intronic
1016206583 6:141474337-141474359 TCTTTATTTCCTCCTTAAAGAGG + Intergenic
1016500634 6:144717265-144717287 TCAAGGTTCTCTCCACAAAGAGG + Intronic
1018378006 6:163231788-163231810 TGTATGGTCCCACCTCAGAGAGG - Intronic
1019791907 7:3019735-3019757 TCTCTGCTCCCTCCTGAAAATGG + Intronic
1020069202 7:5214629-5214651 TCTCAGTTCCCTTCTTAAAGTGG - Exonic
1021177629 7:17468388-17468410 TATATGTCTCCTCCTCAGAGAGG + Intergenic
1026328669 7:69333272-69333294 TCTAGGTTCCCTGCTAAAGGGGG + Intergenic
1028191292 7:87855245-87855267 TCCATGTTCCCTTCTCTAAATGG - Intronic
1028876266 7:95826756-95826778 TAAATGTTACCTCCTCAAAGAGG - Intronic
1030493491 7:110267820-110267842 TCCATTTTGCCTCCTCAAAGGGG + Intergenic
1031271442 7:119654480-119654502 TTTCTGTTGCCTCCTCAAACAGG - Intergenic
1032898788 7:136282490-136282512 TCTATGTTCCCCCCTCCCCGAGG + Intergenic
1036977740 8:13433559-13433581 TCTAACTTTCTTCCTCAAAGTGG + Intronic
1037336730 8:17800118-17800140 TGTATATACCCTCCTTAAAGAGG + Intronic
1037392293 8:18406059-18406081 TCTATTTTTGCTCCTCAAACTGG - Intergenic
1038248921 8:25884454-25884476 TCCATGTCCCCTCTTCAGAGAGG + Intronic
1039405509 8:37309120-37309142 TCTATTTCACCTCCTCCAAGAGG + Intergenic
1040484758 8:47859272-47859294 TCTATGGTCACTCCTCAGGGTGG + Intronic
1041488506 8:58405877-58405899 TCTATTTTCTGTTCTCAAAGTGG - Intergenic
1042721232 8:71828741-71828763 TCTATGTTCCCTCCTTGAACTGG + Intronic
1042768603 8:72354455-72354477 ACTGCCTTCCCTCCTCAAAGAGG - Intergenic
1042864889 8:73348558-73348580 TCAATGTTACCTCCTCAGAGTGG - Intergenic
1044562576 8:93627476-93627498 TCCATGTCCCTTCCTCAAAGAGG + Intergenic
1045036113 8:98177839-98177861 TCAATGTCACCTGCTCAAAGAGG - Intergenic
1045225469 8:100240034-100240056 TTTTTCTTCCCTCCTTAAAGAGG - Intronic
1047663048 8:127059475-127059497 TAAATGTTCCCTTCTCATAGAGG - Intergenic
1050257374 9:3809401-3809423 TCTCTTTTCCCTCCTCAAGATGG + Intergenic
1050397091 9:5210495-5210517 TCCATGTTCCCTCATCAAAGTGG + Intergenic
1050631476 9:7563086-7563108 TCTATGTTGCCTCCTAGAATAGG + Intergenic
1051728578 9:20114294-20114316 TCTATGTTCCCTCTACCATGTGG + Intergenic
1052263125 9:26540432-26540454 TTTATGTTCCCTCCTCAGCTTGG - Intergenic
1053507338 9:38654410-38654432 TCCCCATTCCCTCCTCAAAGTGG - Intergenic
1055375405 9:75644765-75644787 TCCATGCTCCCTCCTGCAAGGGG - Intergenic
1056420082 9:86415893-86415915 CCCATGTCCCCTCCTCAGAGAGG - Intergenic
1056789086 9:89613970-89613992 TTTATTTTCCCCCCTCAAAGTGG + Intergenic
1058717892 9:107738791-107738813 TCTGTGTTAACTCCACAAAGGGG - Intergenic
1061674149 9:132206282-132206304 TTTTTGTTCCATTCTCAAAGGGG + Intronic
1186582216 X:10832175-10832197 TCTATGTTTCATTCTCACAGAGG + Intronic
1188132330 X:26452456-26452478 TCTTTGTGCCCTCCATAAAGTGG - Intergenic
1191019063 X:55841197-55841219 TTTATGTTCCCTCCTCAACTTGG + Intergenic
1191212797 X:57907184-57907206 CTTGTTTTCCCTCCTCAAAGGGG - Exonic
1193295690 X:79829256-79829278 TTTATGTTCCTTCCTCAACTTGG + Intergenic
1194398934 X:93419622-93419644 CCTATGTTCTCTCTTCACAGTGG - Intergenic
1195761778 X:108254265-108254287 TATATGATTCCTCCTAAAAGAGG + Intronic
1196503839 X:116417187-116417209 TCTAAGTTCCAACCACAAAGTGG - Intergenic
1196745444 X:119067807-119067829 TCAATGTCAACTCCTCAAAGAGG - Intergenic
1199249098 X:145638545-145638567 TTTATGTTCCTTCCTCAACTTGG - Intergenic