ID: 1181773057

View in Genome Browser
Species Human (GRCh38)
Location 22:25140633-25140655
Sequence GACCCCGAGGTGCCCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181773057_1181773063 24 Left 1181773057 22:25140633-25140655 CCTGGGAGGGGCACCTCGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1181773063 22:25140680-25140702 GAGGGTCGATGCCAGAGAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 150
1181773057_1181773064 25 Left 1181773057 22:25140633-25140655 CCTGGGAGGGGCACCTCGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1181773064 22:25140681-25140703 AGGGTCGATGCCAGAGAAGTGGG No data
1181773057_1181773065 26 Left 1181773057 22:25140633-25140655 CCTGGGAGGGGCACCTCGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1181773065 22:25140682-25140704 GGGTCGATGCCAGAGAAGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1181773057_1181773059 5 Left 1181773057 22:25140633-25140655 CCTGGGAGGGGCACCTCGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1181773059 22:25140661-25140683 GCCACATGCAGTGAGCCGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 123
1181773057_1181773061 6 Left 1181773057 22:25140633-25140655 CCTGGGAGGGGCACCTCGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1181773061 22:25140662-25140684 CCACATGCAGTGAGCCGTGAGGG 0: 1
1: 1
2: 3
3: 15
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181773057 Original CRISPR GACCCCGAGGTGCCCCTCCC AGG (reversed) Intronic
900087512 1:905417-905439 GGCCCGGAAGTTCCCCTCCCGGG + Intergenic
900148054 1:1166916-1166938 GCCCCCCAGGTGCCCACCCCAGG + Intergenic
900469886 1:2848475-2848497 AACCCAGAGCTGCCCCTCCCAGG - Intergenic
900981740 1:6049664-6049686 GCCCCCGAGGAGCCCCTACAGGG - Intronic
903233882 1:21937373-21937395 GCCCCCGAACCGCCCCTCCCCGG + Intergenic
905004822 1:34701105-34701127 CACTCAGAGGTTCCCCTCCCTGG + Intergenic
905264591 1:36742739-36742761 GACCCAGAGCTGGCCCTGCCTGG - Intergenic
906144582 1:43552350-43552372 GTCCCAGATGTGCCCCTCACTGG + Intronic
906263145 1:44407847-44407869 GCCCCCGAGCAGCCCCGCCCCGG - Intronic
906522861 1:46477549-46477571 CTCCCCTGGGTGCCCCTCCCAGG - Intergenic
906580721 1:46933494-46933516 GACACCAAGGTGCAACTCCCTGG - Intronic
907051163 1:51330582-51330604 GCCCCCGGCGCGCCCCTCCCCGG - Intronic
907706638 1:56838296-56838318 TACCCCAAGGTGACACTCCCTGG + Intergenic
915279777 1:154814493-154814515 GACCCCAGGGTGCCCCTTCTAGG - Intronic
915591546 1:156873938-156873960 AACCCCGAGGACCCCATCCCTGG + Exonic
919916930 1:202144636-202144658 GGCCCGGAGCGGCCCCTCCCCGG + Exonic
923038742 1:230304151-230304173 GACCCAGAGATTCCACTCCCTGG + Intergenic
923193232 1:231640822-231640844 CACCACGCTGTGCCCCTCCCTGG + Intronic
1062898105 10:1120369-1120391 GACCCCCGGGTGCCCCTCGGAGG - Intronic
1064228003 10:13504363-13504385 GACTACCATGTGCCCCTCCCCGG - Intronic
1068467296 10:57410981-57411003 GACTCAAAGGTGCCCCTCCTTGG + Intergenic
1070975661 10:80603853-80603875 GACACCGGGGTCCCCGTCCCGGG + Intronic
1071600220 10:86955345-86955367 GACCCCGAGGGGCCCAGCCCAGG - Intronic
1076006016 10:126948744-126948766 GATCCCAAGCTTCCCCTCCCTGG + Intronic
1076826482 10:132972113-132972135 GACTCCCAGCTCCCCCTCCCTGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077169973 11:1161769-1161791 GACCCCTGGGTGCCCCGTCCAGG + Intronic
1082767103 11:57179135-57179157 GAGCCCCAGGTGCCCCCACCTGG + Intergenic
1082774725 11:57236396-57236418 GACCCCAAGGCCCACCTCCCAGG + Exonic
1083638405 11:64132550-64132572 GACCCCGAGGAGCCGCTGACTGG - Intronic
1083988121 11:66230224-66230246 GACCCCTAGATGCATCTCCCTGG - Intronic
1084266592 11:68008335-68008357 GATCCCGAGGGTCCCCTCCCTGG - Intergenic
1089559362 11:119336028-119336050 GAGCTCCAGGTGCCCCTCCCCGG - Exonic
1089670655 11:120054746-120054768 TACCCCAAGGGGCCTCTCCCAGG + Intergenic
1091093317 11:132793190-132793212 GACCCAGTGCTGCCCTTCCCGGG + Intronic
1091627930 12:2137054-2137076 GACCCCACGGCGCCCCGCCCAGG + Intronic
1095386034 12:41651049-41651071 GCCCCAGTGGTGTCCCTCCCTGG - Intergenic
1098073371 12:66699974-66699996 GTCCCTGACTTGCCCCTCCCAGG - Intronic
1103276039 12:119712560-119712582 GAGCCGGAGGAGCCCCGCCCTGG - Intronic
1104843692 12:131836229-131836251 CACCCCGAGATCCCCCTTCCAGG - Intronic
1104958661 12:132477866-132477888 GCCCCCGAGGTGCACGGCCCAGG - Intergenic
1112323996 13:98431354-98431376 CTCCCCGGGGAGCCCCTCCCTGG - Intronic
1113806967 13:113115616-113115638 GACCCCCAGAAGCCCCTCTCAGG + Intronic
1114736576 14:25049470-25049492 GACCCCGAGCTCCCCCACACTGG + Intronic
1115645349 14:35365487-35365509 GGCCCTGAGGGGCCCCTGCCTGG + Intergenic
1115940249 14:38601193-38601215 GTCCCTGAGGTGCACCTGCCAGG + Intergenic
1119703405 14:76769863-76769885 GCCCCAGAGGCGCCCCACCCTGG - Intronic
1119774271 14:77238871-77238893 CACCCCGGGGTGGCTCTCCCTGG + Intronic
1119893093 14:78197695-78197717 GACCCTGACATGCCCCTCCATGG + Intergenic
1122067625 14:99184648-99184670 GACCCTGTGGTGACCATCCCTGG + Intronic
1122812370 14:104295411-104295433 GACACAGAGGGGCCCTTCCCAGG + Intergenic
1124211805 15:27770318-27770340 GGCCCCGCGTTGCCCGTCCCTGG - Intronic
1128309721 15:66622440-66622462 CTCCCCGGGCTGCCCCTCCCAGG + Intronic
1129295622 15:74598527-74598549 GACCCAGGGGTGCCCCTCGCAGG - Intronic
1129741986 15:77993716-77993738 GGCCCCCAGGGGCACCTCCCTGG + Intronic
1130596845 15:85254916-85254938 GGCCCCCAGGGGCACCTCCCTGG - Intergenic
1131030487 15:89182338-89182360 CTGCCCGAGCTGCCCCTCCCAGG + Intronic
1131272802 15:90957179-90957201 CACCGCGAGGAGCCCCTCCGAGG - Exonic
1132553923 16:564533-564555 GACCCCGAGGACCCCCGCGCTGG - Intronic
1132597714 16:760875-760897 GGTCCCGAGTGGCCCCTCCCAGG - Intronic
1132889325 16:2196286-2196308 GAGCCCCGGGGGCCCCTCCCCGG - Intronic
1137001744 16:35235247-35235269 GAACCCCAGGTGGCCCTCACAGG + Intergenic
1137018029 16:35395114-35395136 GAACCCCAGGTGCACCTCACAGG + Intergenic
1142127357 16:88416843-88416865 GAGCCCTGGGTACCCCTCCCGGG - Intergenic
1143185068 17:5005010-5005032 ATCCCTGAGCTGCCCCTCCCTGG - Intronic
1144661078 17:17071405-17071427 GACACCGTGGTGACTCTCCCAGG - Intronic
1152701818 17:81823225-81823247 GAGCGCCCGGTGCCCCTCCCCGG - Exonic
1152809460 17:82374662-82374684 GTCCCCGAAGTGCCACTCCTTGG - Exonic
1154148402 18:11885742-11885764 GCCCCCGTGGTGCACCTCGCAGG + Exonic
1154492972 18:14935169-14935191 CTCCTCGAGGTACCCCTCCCAGG - Intergenic
1157440330 18:47706555-47706577 TACCCCCAGGTTTCCCTCCCAGG - Intergenic
1157712337 18:49858528-49858550 GAGCCCCAGCAGCCCCTCCCTGG - Intronic
1160155003 18:76426896-76426918 GACCCCTAGCGGCTCCTCCCAGG + Intronic
1160163997 18:76494980-76495002 GCGCCCGGGGGGCCCCTCCCCGG + Intronic
1161152978 19:2719390-2719412 GGCTAAGAGGTGCCCCTCCCAGG - Intronic
1162025024 19:7888786-7888808 GCCCACGAGGTGCCCGTCCTGGG + Intronic
1162118329 19:8445449-8445471 GCCCCCGAGGTCACCCTCCCGGG - Intronic
1162946856 19:14049183-14049205 GACTCCAAGATGCCCCTCCAGGG + Exonic
1163526855 19:17826666-17826688 GGCCCGGAGCTGCCCCTCTCTGG - Exonic
1163696933 19:18768800-18768822 GGCCCCGAGGGACCCCACCCTGG - Intronic
1164778606 19:30873919-30873941 GACCCCTAGCTACCCCTGCCTGG - Intergenic
1165040599 19:33065093-33065115 AACCCCGAGGCGCCGCGCCCAGG - Intergenic
1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG + Intergenic
1165768532 19:38365142-38365164 GACCCCAACCTTCCCCTCCCAGG - Intronic
1165940830 19:39413944-39413966 TACTCCCAGGGGCCCCTCCCTGG + Intronic
1166916452 19:46198853-46198875 GGCCTCAAGGAGCCCCTCCCAGG - Intergenic
1168056162 19:53866459-53866481 GTCCCCGCCCTGCCCCTCCCCGG + Intronic
1168621899 19:57886261-57886283 GACCTCCAGGTACCCCTCCTTGG + Intronic
1168721508 19:58557277-58557299 GACCCCCAGGCGCCTCTCCTGGG + Intronic
927552420 2:24011090-24011112 GAGACCGAGGTGCCCTGCCCTGG + Intronic
927881867 2:26694602-26694624 GACCCAGAGGTGCCCCAGCTGGG - Intronic
931516199 2:63051858-63051880 GAACCCGGGGTGCCACTCTCAGG - Intronic
932746692 2:74339574-74339596 GACCTCCAAGTTCCCCTCCCAGG - Intronic
934952224 2:98584523-98584545 CAGGCCGAGGAGCCCCTCCCAGG + Intronic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
938902079 2:135806996-135807018 GACCCCATGCTGCCCCTCCATGG + Intronic
942452527 2:176117260-176117282 AACCCTGAGGTTCCCGTCCCTGG + Exonic
944090883 2:195910146-195910168 GACCCTCAGGTGCTCCTCCAAGG + Exonic
947592012 2:231391185-231391207 AACCCTGAGGTGCCCTTCCATGG - Intergenic
948703678 2:239776548-239776570 GACCCCGCGGGATCCCTCCCTGG - Intronic
1168750222 20:276901-276923 GGCCCCCAGGTGCCTCTTCCTGG + Intronic
1170727250 20:18941226-18941248 GTCCCAGAGGGGCCCCTGCCAGG + Intergenic
1171249484 20:23637527-23637549 GACCCCGTGCTGCTCCTCTCCGG - Intronic
1172177654 20:32982364-32982386 CACCCCCACATGCCCCTCCCAGG - Intergenic
1173476648 20:43364408-43364430 CACCCCTAGGTGCCCTTCACAGG - Intergenic
1173836400 20:46128812-46128834 GCCTCTGAGGAGCCCCTCCCTGG - Intronic
1174115893 20:48226143-48226165 GACAAGGGGGTGCCCCTCCCTGG - Intergenic
1176100318 20:63361590-63361612 GACCCCGGGGTCCCCGTCCCCGG - Intronic
1176132242 20:63501001-63501023 GACCCCGAGGGGCCACACCGTGG - Intergenic
1176135158 20:63519353-63519375 GGCACCGAGCTCCCCCTCCCAGG + Intergenic
1178704844 21:34864609-34864631 GACCCCGTGGTGGCCCCCTCTGG - Intronic
1181050808 22:20237450-20237472 GACCCCAAAGTGCCAATCCCAGG - Intergenic
1181773057 22:25140633-25140655 GACCCCGAGGTGCCCCTCCCAGG - Intronic
1182293561 22:29299971-29299993 AGCCCCCAGGTGCCCCTTCCTGG - Intronic
1182293584 22:29300041-29300063 AGCCCCCAGGTGCCCCTTCCTGG - Intronic
1183365821 22:37406418-37406440 CACCCCCAGGTGACCCTCCCTGG + Intronic
1183484428 22:38081707-38081729 GTCCCCGGAGAGCCCCTCCCTGG + Intronic
1184217962 22:43079813-43079835 GACCATCAGGTGTCCCTCCCAGG + Intronic
1184789599 22:46691676-46691698 GAGCCCCAGGGGCCTCTCCCCGG - Exonic
1184801452 22:46762858-46762880 GACCCCGACCTGGCCCTCCGCGG - Intronic
1185245502 22:49770957-49770979 GACGCCGAGGCGCTCCTCCGGGG + Intergenic
1185276947 22:49953931-49953953 CACCCACAGGTGCCCCTTCCTGG + Intergenic
954616210 3:51969906-51969928 GAAGCTGAGGTGCCCCTGCCAGG - Intronic
957714960 3:83916158-83916180 GAATCCGAGGTGCCTCTCCTTGG - Intergenic
958839242 3:99183730-99183752 CACCGCGAGCTCCCCCTCCCGGG + Intergenic
962399976 3:135049967-135049989 GACCCTGAGGAGCCCCACCCTGG + Intronic
968426362 4:526245-526267 GACACCCAGGTACCCCTTCCCGG + Intronic
968434152 4:576320-576342 CAGCCCGCGGGGCCCCTCCCAGG + Intergenic
968565352 4:1309706-1309728 GGCCCCGGTGAGCCCCTCCCCGG + Intronic
968705620 4:2076095-2076117 GCCCCTCAGGTGCCCCTCCCAGG + Intronic
969477566 4:7430143-7430165 GTCCCTGACGTGCCCCTCCAGGG + Intronic
969714402 4:8861307-8861329 GATCCCGACCCGCCCCTCCCAGG - Intronic
977960243 4:103076611-103076633 GACCGCGCGGTGCCGCTCCGAGG - Exonic
985480870 5:109473-109495 CACCCCCAGGTGCCACACCCTGG + Intergenic
985664888 5:1176929-1176951 CACCCCCAGGTGCCCTTTCCAGG - Intergenic
993457689 5:88144284-88144306 GCCTCTGAGGTGCCCCACCCCGG + Intergenic
995724583 5:115169934-115169956 CGCCCCGCGGTGCCCCGCCCAGG - Intronic
998232037 5:140367066-140367088 GAGCCTGAGTTGCCCCACCCGGG + Intronic
1001643868 5:173265495-173265517 GCCCCAGAGGGGCCCCTGCCAGG - Intergenic
1002441917 5:179268818-179268840 GACCCAGACGGGCGCCTCCCGGG + Intronic
1004395834 6:15245775-15245797 GACCTCGACGAACCCCTCCCAGG - Intergenic
1017737878 6:157380778-157380800 GGCGCGGAGGTGACCCTCCCCGG - Intergenic
1018612697 6:165660906-165660928 CACCCGGAGGTGCTCCTACCCGG + Intronic
1019330049 7:457109-457131 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330136 7:457310-457332 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019330191 7:457440-457462 GACCCCCAGGTCTCCCACCCCGG + Intergenic
1019389240 7:776509-776531 CACCCTGAGGTCCCCCTTCCCGG - Intronic
1019443046 7:1056981-1057003 GACCCACAGGTCACCCTCCCTGG + Intronic
1022500961 7:30882198-30882220 GACCCCGAGGTTCCCCATCTGGG + Exonic
1022524542 7:31028711-31028733 GTCCCAGAGGTGCCTCTCCCAGG - Intergenic
1029088655 7:98031456-98031478 GACTCCCAGGTCCTCCTCCCTGG - Intergenic
1033339716 7:140482465-140482487 GACCCCGATGTGCCCAACACAGG + Intergenic
1037106689 8:15117281-15117303 CACCGCGAGCTCCCCCTCCCAGG - Intronic
1040624545 8:49131945-49131967 GACCCCGAGGTGACCTTGCTTGG - Intergenic
1050354385 9:4769353-4769375 CCCCCCTAGGTGGCCCTCCCTGG - Intergenic
1058847131 9:108972097-108972119 CAGCCCAAGGTGACCCTCCCGGG - Intronic
1060550342 9:124482013-124482035 CACCCAGAGGTGGCCCTCCCAGG - Exonic
1061419713 9:130466621-130466643 GACCCCCATGGGCCCCTCCCAGG + Intronic
1061828319 9:133275245-133275267 GAGCCCGAGGCGCCCCCTCCCGG + Intergenic
1062017091 9:134296446-134296468 CACCCCCAGCTCCCCCTCCCAGG - Intergenic
1062389437 9:136328038-136328060 CACCCCACGGTGCCCCTGCCAGG - Intronic
1062409163 9:136413619-136413641 GACTCCCAGCTGCCCCTGCCAGG + Intronic
1062583124 9:137236994-137237016 GTCCCCGAGGGGCCCAGCCCAGG - Intergenic
1187783644 X:22859336-22859358 GTCCCTGAGGTGCACTTCCCCGG + Intergenic
1201338772 Y:12908756-12908778 CACCCCAAGCTCCCCCTCCCAGG + Intronic