ID: 1181773825

View in Genome Browser
Species Human (GRCh38)
Location 22:25145458-25145480
Sequence GTGTAGGAACATTTGGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181773811_1181773825 9 Left 1181773811 22:25145426-25145448 CCCTGTCTGATTCCTATTCCCCC 0: 1
1: 0
2: 0
3: 15
4: 283
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773808_1181773825 29 Left 1181773808 22:25145406-25145428 CCCAAGGCCACACAGCATGGCCC 0: 1
1: 0
2: 5
3: 65
4: 457
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773816_1181773825 -3 Left 1181773816 22:25145438-25145460 CCTATTCCCCCAGGGACATGGTG 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773812_1181773825 8 Left 1181773812 22:25145427-25145449 CCTGTCTGATTCCTATTCCCCCA 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773819_1181773825 -10 Left 1181773819 22:25145445-25145467 CCCCAGGGACATGGTGTAGGAAC No data
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773818_1181773825 -9 Left 1181773818 22:25145444-25145466 CCCCCAGGGACATGGTGTAGGAA 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773809_1181773825 28 Left 1181773809 22:25145407-25145429 CCAAGGCCACACAGCATGGCCCT 0: 1
1: 0
2: 10
3: 250
4: 3139
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773807_1181773825 30 Left 1181773807 22:25145405-25145427 CCCCAAGGCCACACAGCATGGCC 0: 1
1: 1
2: 6
3: 37
4: 305
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data
1181773810_1181773825 22 Left 1181773810 22:25145413-25145435 CCACACAGCATGGCCCTGTCTGA 0: 1
1: 1
2: 2
3: 38
4: 455
Right 1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181773825 Original CRISPR GTGTAGGAACATTTGGGATT GGG Intronic
No off target data available for this crispr