ID: 1181775017

View in Genome Browser
Species Human (GRCh38)
Location 22:25153329-25153351
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 19, 1: 56, 2: 83, 3: 122, 4: 333}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181775017_1181775019 -7 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775019 22:25153345-25153367 TTTTGGTTGTTGTGATGGAATGG 0: 1
1: 0
2: 4
3: 35
4: 385
1181775017_1181775024 17 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775024 22:25153369-25153391 GTGCTACTGACATTGGTGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 175
1181775017_1181775025 25 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775025 22:25153377-25153399 GACATTGGTGGCTGGAGTCCAGG No data
1181775017_1181775026 26 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775026 22:25153378-25153400 ACATTGGTGGCTGGAGTCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1181775017_1181775023 13 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775023 22:25153365-25153387 TGGGGTGCTACTGACATTGGTGG 0: 1
1: 0
2: 3
3: 16
4: 138
1181775017_1181775022 10 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775022 22:25153362-25153384 GAATGGGGTGCTACTGACATTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1181775017_1181775020 -6 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775020 22:25153346-25153368 TTTGGTTGTTGTGATGGAATGGG 0: 1
1: 0
2: 2
3: 20
4: 294
1181775017_1181775021 -5 Left 1181775017 22:25153329-25153351 CCTTGTCTGGAGACATTTTTGGT 0: 19
1: 56
2: 83
3: 122
4: 333
Right 1181775021 22:25153347-25153369 TTGGTTGTTGTGATGGAATGGGG 0: 1
1: 0
2: 2
3: 22
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181775017 Original CRISPR ACCAAAAATGTCTCCAGACA AGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904628139 1:31820254-31820276 ACCAAAAATTTAGTCAGACATGG - Intergenic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905251540 1:36651973-36651995 ACCACTAATGACTCCAGTCAAGG + Intergenic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911289335 1:96037959-96037981 AACAAAACTGTCTCCTGCCATGG + Intergenic
911583347 1:99660728-99660750 ACCAAAAAATTATCCAGGCATGG + Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911731170 1:101293814-101293836 ACCAAATATGACTCAAGACCAGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915075313 1:153303788-153303810 CCCAAACATGACTCCAAACATGG + Intronic
915317938 1:155040145-155040167 ACCAAAAAATTAGCCAGACATGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
920707997 1:208268919-208268941 ACCAGCCTTGTCTCCAGACAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921412487 1:214850552-214850574 ACCAAAAATGTCTCATTCCATGG - Intergenic
922123387 1:222697941-222697963 ACCAAATTTGACTCAAGACAGGG + Intronic
922144321 1:222923772-222923794 CCGAAAAAAGTCACCAGACAAGG - Intronic
922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG + Intergenic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1063529452 10:6817301-6817323 CCCTAAAATGTTTCCATACATGG + Intergenic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072289667 10:93952523-93952545 ACCAACCAAGTCTCCCGACATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074228194 10:111508025-111508047 ACTAATAATGTCTTCAGAGATGG - Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076269799 10:129141824-129141846 ACCAAAACTGTTTCAAAACAGGG + Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078281252 11:9903422-9903444 ACCAAATATGTTACCAGTCAAGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087200362 11:95338669-95338691 AACAAAAATGCTGCCAGACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089226795 11:116930931-116930953 TCCAAACATGTACCCAGACAGGG + Intronic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1097349546 12:58533507-58533529 ACCAAAAATTTCACAAGTCAGGG - Intergenic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1098311821 12:69156482-69156504 ACCAAAAATCTCTCCTGGCCAGG + Intergenic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1098727380 12:73984747-73984769 ACCTTAAATGACTCAAGACAAGG - Intergenic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1099682774 12:85848980-85849002 AACAAAAATTTATCCAGGCATGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109406709 13:61909718-61909740 ACCAAAAGTGTCACCAGCCTGGG - Intergenic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1117975170 14:61290001-61290023 AGGAAAAATGTGTCCAGGCACGG + Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122390518 14:101378649-101378671 ACCCAAAAGGTATCCAGAAATGG + Intergenic
1122777426 14:104127218-104127240 ACCACAAATGTCTCAGGAAAAGG - Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130762954 15:86839704-86839726 ACCAAAATTGCCTCCTGTCAAGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133397877 16:5462766-5462788 ACCAAAAAGGACTCCAGAAGAGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1137952269 16:52794875-52794897 ACCAAAAGTGACTCCAGATGGGG + Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141521991 16:84586738-84586760 ACCAAAAAAGTAGCCAGGCATGG - Intronic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145021242 17:19433028-19433050 ACCAAAAATGTCTCCCCAAGTGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148094784 17:45044772-45044794 CCCTAAACTGTCTCAAGACAAGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1155785544 18:29895266-29895288 TCCAAAAATTGCTCCAGATATGG - Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161279894 19:3440301-3440323 ACCGTAAATGTCCCCAGACCTGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163398742 19:17079082-17079104 ACTGAAAATGACTCCAGCCATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1164599233 19:29549678-29549700 ACCATATATGTCTCCCCACAGGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1167473430 19:49687537-49687559 ACCACAAATGTTTCCACAGACGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
935502447 2:103857878-103857900 ACCAAAAATCACTGCAGTCATGG - Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948118418 2:235511052-235511074 ACCGAAAATTGCCCCAGACATGG - Intronic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169849075 20:10031133-10031155 ACCAACTTTGTCTCCAAACATGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175629286 20:60519686-60519708 CCCAAATATGTCTCCAGCCTTGG + Intergenic
1175641783 20:60636193-60636215 ACCTGAAATGTCACCATACATGG - Intergenic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1178497976 21:33102923-33102945 ACCAATAATTTCACCAGCCAGGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182900533 22:33894677-33894699 ACCAGATATGGGTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184588132 22:45461552-45461574 ACCAAAAAATTATCCAGGCATGG + Intergenic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952087483 3:29843552-29843574 ACAAAAAATGTATCGAGCCACGG + Intronic
952246176 3:31595005-31595027 ACCAATAAAGTCTCCATAAAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953762212 3:45697751-45697773 ACCAAATATCTGTCAAGACAAGG - Intronic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
958943145 3:100336205-100336227 AACGCAAATGTCTCCAGAAAAGG - Intronic
959443907 3:106413296-106413318 ACTAAAAATGTGTCAAGAGAGGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
960086315 3:113595275-113595297 ACTAAAAATGCCTCCAGGCTTGG + Intronic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962461367 3:135616445-135616467 ACTAAAACTTTCTCCAGACCAGG + Intergenic
962485874 3:135841717-135841739 AGCAAACATGCCTCCAGCCAAGG + Intergenic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963237512 3:142970336-142970358 CCCAGTACTGTCTCCAGACAGGG - Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967791470 3:193553577-193553599 TCCACAAATGTCACCAGAAATGG - Intronic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
971246040 4:24928902-24928924 ACCATAAATGTCACCTGAAAAGG - Intronic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976180229 4:82391917-82391939 ACCAGAAAGCTCTCCAGTCATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978314715 4:107422871-107422893 ACCTAAAATTTCTCCACACCAGG + Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984820589 4:183878218-183878240 TCTAAAAATGTCTCCAGCAAGGG - Intronic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989388143 5:40873360-40873382 ACCAAAAAATTAGCCAGACATGG + Intergenic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997645668 5:135480185-135480207 ACCAAAAATGCCACCTGGCAAGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
999553170 5:152712382-152712404 ACCAATAATGATTCCAGAGATGG - Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006593429 6:35175099-35175121 ACCAAAAAAGTAGCCAGGCATGG + Intergenic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1019794678 7:3041069-3041091 ACCAAAAAATTAGCCAGACATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1026411319 7:70126126-70126148 ACCAAATATGTGGCCAGGCATGG + Intronic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027657905 7:80954151-80954173 ACCAAAAATGTATTCGTACAGGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028898204 7:96065531-96065553 ACCAAAAATTTAGCCAGGCATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032151316 7:129432625-129432647 ACCAAAAATGTCTCGGGGCGGGG - Intergenic
1032572123 7:133011572-133011594 ACCTAAAAGGTCTCCAGGTATGG + Intronic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035415076 7:158676601-158676623 CCCAAATATGTTTCAAGACAGGG + Intronic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1039622197 8:39008324-39008346 ACCAAAAAATTAGCCAGACATGG - Intronic
1040412489 8:47168510-47168532 AGCAAGAATGTCTCCATCCAAGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051838392 9:21366103-21366125 ACCAAAAATTTGGCCAGGCATGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052883608 9:33622304-33622326 TCCAAAAATGGCACCAGATAGGG - Intergenic
1054849854 9:69836433-69836455 CGCAACAATGTCTCCAGGCATGG + Intronic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059759143 9:117321875-117321897 ACCAAAACTGGCTCCAAATATGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186524914 X:10239459-10239481 ACCACAAAAGTTTCCAGGCATGG - Intergenic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189550506 X:42087645-42087667 ACCAATCATGTCACCAAACAAGG - Intergenic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1190935265 X:54993992-54994014 TCCTAAGATGTCTCCAGAGATGG - Exonic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1192895902 X:75442229-75442251 ACCAAAACTGGCACAAGACAGGG + Intronic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195645690 X:107228578-107228600 ACCAAAAATGCCTCCACCTAGGG - Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196048451 X:111280552-111280574 ACCAAAGATTTCTACATACATGG + Intergenic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1198142522 X:133818943-133818965 ACCAAAAGGGTCTCCAGTCTAGG - Intronic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199290791 X:146102846-146102868 ACCAAAAACGTAGCCAGAGAAGG - Intergenic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic