ID: 1181775473

View in Genome Browser
Species Human (GRCh38)
Location 22:25156913-25156935
Sequence TACGTGTAAACCTGTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181775473 Original CRISPR TACGTGTAAACCTGTTGAGG AGG (reversed) Intronic
905693310 1:39958016-39958038 AAAGTGTAAACCTGTTGTAGTGG + Intronic
918792607 1:188849098-188849120 TATATGTAAACATTTTGAGGGGG - Intergenic
922607001 1:226895696-226895718 TACGTGTTTACTTGGTGAGGAGG + Exonic
1065727572 10:28680492-28680514 TACATGTAAAACTTGTGAGGAGG + Intronic
1076059781 10:127404646-127404668 TACGTGTAAATCTCTGAAGGAGG - Intronic
1083966499 11:66046958-66046980 TACATTTAAACCTGTTTGGGTGG + Intronic
1088114432 11:106299238-106299260 TTCTTGTAAACCTGTAGTGGAGG + Intergenic
1096254925 12:50057104-50057126 TACGTGGACATCTGTTGCGGGGG + Intergenic
1101776392 12:107798345-107798367 TACCTATAAACATTTTGAGGGGG - Intergenic
1119201450 14:72755840-72755862 TGCCTGTCAGCCTGTTGAGGAGG - Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1145905861 17:28515939-28515961 GGGGTGTACACCTGTTGAGGAGG - Intronic
1146806610 17:35869831-35869853 TACTTGTAAACCTGTTAAACTGG + Intergenic
1150562360 17:66304038-66304060 GACCTGTAACCCTGTTGATGAGG + Intronic
943339283 2:186658667-186658689 TACATGTAATCCTATTGAGAAGG + Intronic
943990903 2:194691323-194691345 AACGTGTAAAGCTGTTTAGGTGG + Intergenic
1178465049 21:32840403-32840425 ATCTTGTAAACATGTTGAGGAGG - Intergenic
1181775473 22:25156913-25156935 TACGTGTAAACCTGTTGAGGAGG - Intronic
954978235 3:54717355-54717377 CACATGTATACCTTTTGAGGTGG - Intronic
957765480 3:84619496-84619518 CACGTGTAAGCTTGGTGAGGTGG - Intergenic
963290153 3:143479170-143479192 TATGTGTGAACTTGTTGGGGTGG + Intronic
966292201 3:178372868-178372890 TAAGGGTAAACCAGTTGGGGTGG - Intergenic
967586818 3:191223229-191223251 TACGTGAAAATCTGTTCAGATGG - Intronic
985249034 4:188004619-188004641 TAAGTTTAAACATGTTGTGGGGG - Exonic
990711071 5:58581547-58581569 TACTTGAAAATCTGTTGAGACGG - Intergenic
995533548 5:113114015-113114037 TATGTGTAAACCTTTTAAGAAGG - Intronic
1002798556 6:497945-497967 TATGTGTAAAATTGTGGAGGGGG - Intronic
1008372678 6:50752503-50752525 AAATTGTAAAGCTGTTGAGGAGG + Intronic
1014231717 6:118910801-118910823 TAAGTGGAAAACTGTTAAGGAGG - Intronic
1014680569 6:124424711-124424733 TACGGATAAACCTGGTGGGGGGG - Intronic
1015811108 6:137163227-137163249 TACGTTTAAACATCTTAAGGTGG - Intronic
1017577222 6:155818397-155818419 TAAGAGTAAGTCTGTTGAGGTGG + Intergenic
1023144222 7:37133372-37133394 TCCATGTAAACCTACTGAGGTGG + Intronic
1045093830 8:98776216-98776238 TAAGTGTAAACCTGCTGTGTGGG + Intronic
1051516966 9:17940534-17940556 TACTTGTTGACCTGTTGAGTTGG + Intergenic
1059501889 9:114761918-114761940 GATGTGCAAACCTGTTGAGGTGG - Intergenic
1061497824 9:130985768-130985790 TGCGAGTACACCTGGTGAGGAGG + Intergenic
1194773548 X:97934533-97934555 TACGTTTTCACCTGTTCAGGAGG + Intergenic