ID: 1181780706

View in Genome Browser
Species Human (GRCh38)
Location 22:25190896-25190918
Sequence CTGTGTAAGGGGAAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181780697_1181780706 19 Left 1181780697 22:25190854-25190876 CCACGCTTCAGAGACTGGGGCTG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG 0: 1
1: 0
2: 2
3: 35
4: 311
1181780701_1181780706 -10 Left 1181780701 22:25190883-25190905 CCAAGGAAAGAGGCTGTGTAAGG 0: 1
1: 0
2: 3
3: 32
4: 256
Right 1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG 0: 1
1: 0
2: 2
3: 35
4: 311
1181780700_1181780706 -9 Left 1181780700 22:25190882-25190904 CCCAAGGAAAGAGGCTGTGTAAG 0: 1
1: 0
2: 1
3: 22
4: 183
Right 1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG 0: 1
1: 0
2: 2
3: 35
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181780706 Original CRISPR CTGTGTAAGGGGAAGAATGA GGG Intronic
902916212 1:19641190-19641212 CTGTAAAATGGGAACAATGATGG + Intronic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903872308 1:26445136-26445158 CTGTAAAAGGGGAATAATAAGGG + Intronic
904354097 1:29927219-29927241 CTGTGAAATGGGAACAATCACGG + Intergenic
904703509 1:32373449-32373471 CTGAGTACGGGAGAGAATGAGGG - Intronic
905092265 1:35439038-35439060 CTTTTTAAGGGGATGAATGGTGG - Intronic
905874100 1:41421450-41421472 CTGGGAAGGGGGAAGAAAGATGG + Intergenic
906716822 1:47976253-47976275 GTGTGTAAGGGGTAGAAGGTTGG - Intronic
907332991 1:53683493-53683515 CTGTGAAATGGGGAGAATGAGGG + Intronic
908066743 1:60414394-60414416 CTTTGAAAGGACAAGAATGATGG - Intergenic
908499177 1:64725764-64725786 CTTTGTCATGGGAAGAGTGAGGG + Intergenic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
909329630 1:74396047-74396069 CTCTTTAAGGGGGAGCATGAGGG - Intronic
909802285 1:79825320-79825342 CTATGCAAAGGGAAGAATGGAGG - Intergenic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
911252027 1:95587208-95587230 CTGTGTAAGGGGAAAACTGTTGG - Intergenic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
913972428 1:143424599-143424621 CTGTGAAAGGGTAAGAATTGAGG - Intergenic
914066810 1:144250212-144250234 CTGTGAAAGGGTAAGAATTGAGG - Intergenic
914112343 1:144716142-144716164 CTGTGAAAGGGTAAGAATTGAGG + Intergenic
915262342 1:154686122-154686144 CTGCAAAAGGGGAATAATGATGG - Intergenic
915700190 1:157784748-157784770 TTGTGTGAGGGGGAGGATGAAGG - Intergenic
917215025 1:172669336-172669358 GTTCGTAAGTGGAAGAATGAAGG - Intergenic
917773425 1:178305967-178305989 ATGTGTATGGGGAAGAAGAAGGG + Intronic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
920494401 1:206444392-206444414 CTGTGGAAGATGAAGAATGTTGG - Intronic
920692191 1:208155451-208155473 GTGTGGGAGGGGCAGAATGAGGG - Intronic
922112129 1:222570179-222570201 CTATATGAGGTGAAGAATGATGG - Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923368607 1:233287839-233287861 CTGTAAAATGGGAATAATGATGG + Intronic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063999752 10:11653750-11653772 CTGTTCCAGGGGAAGTATGATGG - Intergenic
1065419402 10:25525650-25525672 CTGTGGCAGGGGAAGAATGGGGG + Intronic
1065463796 10:25997803-25997825 CTGAGAGAGGGGAAGAATGGGGG + Intronic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1066784211 10:38984884-38984906 CTGTTTCAGAGAAAGAATGAAGG - Intergenic
1066983840 10:42445596-42445618 CTGTTTCAGAGAAAGAATGAAGG + Intergenic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067709309 10:48635686-48635708 CAGTGTGAGGGGCATAATGAAGG - Intronic
1067739083 10:48881272-48881294 CCGTGTCAAGGGAAGGATGAAGG + Intronic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1072104631 10:92262438-92262460 CTGTGAAATGGGGATAATGAAGG - Intronic
1073035008 10:100557999-100558021 GTGTGAATGGGGAAGAATCATGG + Exonic
1073134208 10:101211047-101211069 CTCTGTGGGGGGAAGAAAGAAGG - Intergenic
1074148881 10:110740710-110740732 CTGAGTAAGGGGATGAATAAAGG - Intronic
1075232036 10:120688641-120688663 ATGTGTAATGGGAAAAATGGTGG + Intergenic
1075480354 10:122775817-122775839 CTGTAAAAGGGGAAGAACCATGG - Intergenic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1075931488 10:126300397-126300419 TTTGGTAAGGGGAAGAAGGAAGG - Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1078535015 11:12165951-12165973 CTGTGTTTGGATAAGAATGAGGG + Intronic
1078815298 11:14815213-14815235 CTTTGTCAGTGGAAGAATTATGG + Intronic
1079431596 11:20394964-20394986 TTGTGTAATGGGAAGAACGTGGG + Intronic
1079897919 11:26146134-26146156 CTGTGAAAGGTAAAGAATTAGGG - Intergenic
1081071485 11:38615784-38615806 CTCTATAAGGGGAACAATAAAGG - Intergenic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1081761335 11:45578141-45578163 CTGTGAAATGGGAAAAATCATGG + Intergenic
1084564913 11:69923208-69923230 GTGTGCCAGGGGAAGAATGCAGG + Intergenic
1084673590 11:70621739-70621761 GTGGGTATGGGGAAGAATGATGG + Intronic
1086358633 11:86033609-86033631 CAGAGTAAGGGGGATAATGAGGG - Intronic
1086669926 11:89533868-89533890 CTGTTTCAGGGGAAGGATGTGGG - Intergenic
1087611594 11:100440925-100440947 GTGTGTTTGAGGAAGAATGAAGG + Intergenic
1087915907 11:103810556-103810578 CTGAGTATGAGGAAGACTGAAGG - Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090075040 11:123575229-123575251 CTGGGTTTGGGGAAGGATGAAGG + Intronic
1091112383 11:132981901-132981923 CCTTGTAAGGAGAAAAATGAAGG + Intronic
1092040790 12:5382443-5382465 ATGTGTAAGGGCAAGGATGGAGG + Intergenic
1092362336 12:7847702-7847724 CTCTCTCTGGGGAAGAATGAGGG - Intronic
1092378657 12:7976994-7977016 CTCTCTCTGGGGAAGAATGAGGG - Intergenic
1093858889 12:24138997-24139019 CAGTGTAAGGGGAAAACTCAGGG - Intergenic
1094325170 12:29230325-29230347 CTGGGTAGGGGGAGGAGTGAGGG + Intronic
1096556083 12:52404857-52404879 GTGAGGAAGGGGAGGAATGACGG - Intronic
1096791734 12:54049187-54049209 ATGTGGAAGGGGAAAAATGAAGG - Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098935119 12:76469993-76470015 CTATTTAAGGAAAAGAATGAGGG - Intronic
1100108585 12:91208972-91208994 CTGTATCAGGGGAAAAAAGAAGG - Intergenic
1100610610 12:96189204-96189226 CTGTGTGAGGGCAAAAAAGACGG + Intergenic
1101498987 12:105283722-105283744 CTGTGTAAGGGTAAGAGTGGAGG + Intronic
1101553259 12:105783324-105783346 CTCTGTAAAGAGTAGAATGATGG - Intergenic
1102768219 12:115451511-115451533 CTGGGAAACGGGAAGAATAAAGG - Intergenic
1102810057 12:115816338-115816360 CTCTCTAAGGGACAGAATGAAGG + Intergenic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1104169858 12:126269577-126269599 CTCTGTAAGAGGAATCATGAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107180009 13:37448094-37448116 CTTTTTGAAGGGAAGAATGAGGG - Intergenic
1107328735 13:39273941-39273963 TTCTGAAAGGGGAAGAATGAAGG + Intergenic
1108192844 13:47960112-47960134 CTGAGTAGGGGAAAGATTGAGGG + Intronic
1108475043 13:50807629-50807651 TATTGTAAGGGGAAGAAAGAGGG + Intronic
1110527633 13:76557543-76557565 CTGTGTCAGGGGAAAAAGGCAGG - Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1111853977 13:93612789-93612811 GTATGTAAGAGAAAGAATGATGG - Intronic
1112417353 13:99214703-99214725 CTGCTTAAGGAGAACAATGAGGG - Intronic
1113322193 13:109244895-109244917 GTGAGTAAGGAGAAGAATGTTGG + Intergenic
1116216195 14:42020471-42020493 TTTTGGAAGGGGAAGAATGCAGG - Intergenic
1116475283 14:45331933-45331955 CGGTGTAAAGAAAAGAATGAGGG - Intergenic
1117503495 14:56377261-56377283 CTTTATAAGGGAAAGAAGGAAGG - Intergenic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118158662 14:63266972-63266994 CTGTGTCAGGGGTAGTGTGAGGG - Intronic
1118525585 14:66637732-66637754 CAGTGTAATGGGTAGAATAATGG + Intronic
1118609017 14:67525511-67525533 TTATGTTAGGAGAAGAATGAGGG - Intronic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1122286252 14:100654622-100654644 CTGTGAAATGGGGCGAATGAGGG + Intergenic
1122468713 14:101951392-101951414 CTCTGAAAGGGAAGGAATGATGG + Intergenic
1123829082 15:24115448-24115470 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123844002 15:24278892-24278914 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123859079 15:24445174-24445196 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1124838162 15:33215768-33215790 CTGTGAAAAGGGAAGAATTGAGG - Intergenic
1125169515 15:36750246-36750268 CTGTTTCATGGGACGAATGAGGG - Intronic
1128520134 15:68369725-68369747 CCCTGTAAGATGAAGAATGAGGG - Intronic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1130528263 15:84725402-84725424 TTGTGATAGGGGAAGAATGAAGG - Intergenic
1131389015 15:92032246-92032268 GTGTGGCAGGGGGAGAATGAGGG + Intronic
1131514723 15:93069554-93069576 AAGTATAAGGGGAAGAAAGAAGG + Intronic
1131557502 15:93412586-93412608 CTGCTTCAGGTGAAGAATGAGGG + Intergenic
1131878195 15:96833699-96833721 CTGTGTACGGGGCAGATTGTAGG + Intergenic
1132849215 16:2016913-2016935 CTGTGACAGGGGCAGAATGGGGG - Intronic
1135475282 16:22769076-22769098 CACTGAAAGGGGAAGAATGTGGG - Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1138459716 16:57141057-57141079 TTGTTTAAGGGGAAAAATGTGGG + Intronic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1139319518 16:66102334-66102356 CAGTGAATGGGGAAGTATGAGGG + Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1143818247 17:9537386-9537408 CTGTGACTGGAGAAGAATGAGGG - Intronic
1144628994 17:16860712-16860734 CTGTGAAACGGGAAGAACCACGG - Intergenic
1144652419 17:17015402-17015424 CTGTGAAACGGGAAGAACCACGG + Intergenic
1145157543 17:20553198-20553220 CAGGGTAAGGGGAAGAAACAGGG + Intergenic
1145160566 17:20571278-20571300 CTGTGAAACGGGAAGAACCATGG - Intergenic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1147309259 17:39584744-39584766 ATGAGCAAGGGGAAGATTGAAGG + Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1149002955 17:51775820-51775842 ATGTATGTGGGGAAGAATGAGGG + Intronic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149666423 17:58367974-58367996 CTGTAAAAGGGGAATAATAATGG - Intronic
1149795406 17:59514501-59514523 CTGTGCTAGGGGAAAGATGATGG - Intergenic
1151341999 17:73477529-73477551 CTGTAAAATGGGAATAATGATGG + Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1153796884 18:8631683-8631705 TTTTGTAAGGGGAAGAAATATGG + Intronic
1155772603 18:29721257-29721279 CTGTTTAAGTGGATTAATGAAGG - Intergenic
1155819592 18:30358158-30358180 CTGTGTAATGGAAATAATGTTGG - Intergenic
1156888140 18:42159260-42159282 GTAGGTAGGGGGAAGAATGAAGG - Intergenic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157306255 18:46519746-46519768 CTGTGTAAAGGAGAGAAAGATGG - Intronic
1158102782 18:53849161-53849183 ATGTGTAATGTGAAGAATGGGGG + Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168629213 19:57944111-57944133 ATGTGTGAGGGGAAGGATTATGG - Intronic
925842000 2:8001215-8001237 CTGTGAAATGGGAACAATAATGG - Intergenic
928395158 2:30938010-30938032 GTGTGTTATGGGAAGAATGTGGG - Intronic
928498925 2:31866206-31866228 CTGGTGAAGGGGCAGAATGATGG + Exonic
929391678 2:41475682-41475704 CTGGGAAAGGAGAAGAATTAGGG - Intergenic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
933832893 2:86224890-86224912 CAGTGTCAGGGGAAGAATGGAGG + Intronic
934177121 2:89585537-89585559 CTGTGAAAGGGTAAGAATTGAGG - Intergenic
934237486 2:90244991-90245013 CTGTGAAAGGGTAAGAACCAAGG - Intergenic
934287428 2:91659896-91659918 CTGTGAAAGGGTAAGAATTGAGG - Intergenic
935452140 2:103222087-103222109 ATGTGGAAGGGGAAGAATCCAGG - Intergenic
935617160 2:105098161-105098183 CTGTGTAATGTGAAAAAGGATGG + Intronic
935949315 2:108314478-108314500 CTGTCTCAGGGCAAGAAGGAAGG + Intergenic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
939585184 2:143995946-143995968 CTGAGTAAGTGGATAAATGAAGG - Intronic
946446356 2:219742857-219742879 ATCTGTAAGGGGAAGAAATATGG - Intergenic
946592138 2:221262462-221262484 TTGCATAAGGGGAAGGATGAAGG - Intergenic
947731936 2:232436055-232436077 CTGTGTCAAGGGGAGACTGAAGG - Intergenic
948027960 2:234792847-234792869 CTGTGTAAAAGGAAAATTGATGG - Intergenic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
948989693 2:241547335-241547357 CTGCTTAAGGGAAGGAATGACGG + Intergenic
1169131396 20:3167962-3167984 CTGCGAAATGGGAGGAATGAAGG + Intronic
1170585113 20:17728520-17728542 CTGTGTGAGAGGAGGAATGGAGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1172765575 20:37348987-37349009 GTGGGTAAGAGGTAGAATGAGGG + Intronic
1174197412 20:48783336-48783358 CTGAGCAAGTGGAAGAATGGAGG + Intronic
1174740123 20:53004872-53004894 CTGTAAAATGGGAATAATGATGG - Intronic
1176904562 21:14483840-14483862 CTGTGAAGGGGGAAGAATAGAGG + Intergenic
1177173516 21:17679696-17679718 ATGTGTAAGGGGAAGCGTCAGGG - Intergenic
1177743019 21:25176566-25176588 CTCTATTAGGGAAAGAATGAAGG - Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178803800 21:35821665-35821687 CTTTGGAAGGTGAAGACTGAAGG + Intronic
1178897878 21:36575395-36575417 CTGTAAAATGGGAATAATGATGG - Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182357031 22:29726897-29726919 CAGTGAAATGGGCAGAATGATGG - Intronic
1183247776 22:36707134-36707156 CTGTAAAATGGGAATAATGATGG - Intergenic
1183298921 22:37048817-37048839 AGCTGTATGGGGAAGAATGAGGG - Intergenic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1185125678 22:49009468-49009490 CTGTGTAATGGGCTGAATGGGGG - Intergenic
1185419985 22:50729815-50729837 CTGTGTCAGGGGAAGCCTCAAGG - Intergenic
949104010 3:181719-181741 CTGGGAAATGGGAACAATGATGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950851350 3:16064757-16064779 ATGTGCAAGGGGAAGATTAATGG + Intergenic
950948703 3:16977337-16977359 CTGTGGGAGGGGAACAATGAGGG - Intronic
951601627 3:24382812-24382834 AAGTGAAAGGGGAAAAATGAAGG - Intronic
951610120 3:24482326-24482348 CTGTGCAAGGGAAAGAATGTTGG - Intronic
951711949 3:25592196-25592218 CTGTGTAACAGGAATAATGCAGG + Intronic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
954380645 3:50217285-50217307 CAGTGCCAGGGGCAGAATGATGG - Exonic
954989081 3:54823226-54823248 GTGTGTAAGGGGAAAAATCAGGG + Intronic
955044750 3:55349222-55349244 CTGAGTATGGGGAAGAAGCATGG - Intergenic
955216978 3:56992284-56992306 CTGTGAAATCTGAAGAATGAAGG + Intronic
956163547 3:66379563-66379585 GTCTGTAAGGCGTAGAATGAGGG - Exonic
956214619 3:66835680-66835702 CTGTGTAAAGGGAAGAAAATGGG + Intergenic
956898513 3:73688482-73688504 TTAAGTAAGGGGATGAATGAGGG - Intergenic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
959935000 3:112020117-112020139 CTGTGTAAAAGGAATAAAGATGG + Intergenic
960210696 3:114961971-114961993 CTGTTCAACGGGAAAAATGAAGG + Intronic
961259133 3:125585733-125585755 ATGGAAAAGGGGAAGAATGAGGG - Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
961765330 3:129205931-129205953 TTGTGTACGTGGCAGAATGATGG + Intergenic
962166495 3:133054721-133054743 CTGTGTCAGGGTAAGAATGATGG + Intronic
962201693 3:133405388-133405410 CTGTGCAAGGGACAGAAAGACGG - Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967765461 3:193274473-193274495 GTGTGGAAGTGGTAGAATGAAGG - Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
970355318 4:15245389-15245411 CTGTGTAAGAGAGAAAATGATGG + Intergenic
970821872 4:20226177-20226199 CTTTATAAGGGAAAGAAGGAGGG + Intergenic
971394679 4:26216999-26217021 ATGTGAAAGGGGAAAACTGAGGG + Intronic
971699580 4:29952936-29952958 CTCTGGAAGGGGCAGAATTATGG + Intergenic
972139258 4:35936491-35936513 CTGTAAAATGGGAATAATGATGG + Intergenic
974398856 4:61374772-61374794 CTGTGCAGGGGGCAGAATGTGGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976198323 4:82555548-82555570 CTGTGTAAGAGGAGGCCTGATGG - Intronic
976268290 4:83205627-83205649 CTTTGTAAGGGTACCAATGAAGG - Intergenic
976312352 4:83624394-83624416 TGGTGTAAGGGGAAGCATGGTGG - Intergenic
977809244 4:101340061-101340083 CTGTGAAACCGGAAGAATGATGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978454641 4:108875070-108875092 GTGTGGAAGGGAATGAATGAAGG + Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979808368 4:125003450-125003472 TTGTGAAAGAGAAAGAATGAAGG - Intergenic
979834951 4:125354681-125354703 GTGTGGAAATGGAAGAATGAAGG + Intronic
981774195 4:148346243-148346265 TTGTGTTATGGCAAGAATGAAGG + Intronic
981786876 4:148489440-148489462 CTGAGGAACTGGAAGAATGAAGG - Intergenic
981787093 4:148491767-148491789 CTGAGGAATTGGAAGAATGAAGG - Intergenic
982134712 4:152263767-152263789 CTGTGTAATTGGAAAAATGAAGG - Intergenic
982513390 4:156313266-156313288 CTGAGTAAGAGGAAAAATAAAGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984189127 4:176583664-176583686 GTGTGTATGGGGAAGAGAGAAGG + Intergenic
984603780 4:181760306-181760328 ATGTTTAAGGGGAATAATTATGG - Intergenic
986138973 5:5011684-5011706 CTGTATTAGGGAAAGAATTAGGG + Intergenic
986504396 5:8433630-8433652 CTATGGAAGGGGAAGGATGTGGG - Intergenic
987500702 5:18705958-18705980 TTATGTAGGGGGAAAAATGAAGG - Intergenic
987913468 5:24180983-24181005 CTGAATTAGGGGAAGAATCAAGG - Intergenic
989712313 5:44414193-44414215 CTGTGTGAGGCAAGGAATGATGG + Intergenic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
992852191 5:80822096-80822118 CTGTGTATGGGAAAGAATAGGGG + Intronic
993126986 5:83847424-83847446 CTGCATAAGGGGGAAAATGAGGG - Intergenic
993167326 5:84373989-84374011 GTTTTTAAGGGGACGAATGATGG + Intronic
993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG + Intergenic
993398365 5:87418548-87418570 CTGGGTAATGGGGAGAATGATGG + Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994131056 5:96227887-96227909 ATGTGTAAGGGCAAGTATGGTGG + Intergenic
995144899 5:108776194-108776216 ATATGTTGGGGGAAGAATGAAGG + Intronic
995291707 5:110463889-110463911 CTGTGTAAGGGGTAGAAATAAGG - Intronic
995313151 5:110736684-110736706 CTCTGTATGGGGAAGAGTAAAGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997583189 5:135029958-135029980 CTGTTTAAGGGGAACAGTGCAGG - Intronic
998063604 5:139138532-139138554 CAGTGTAATAGGAAGAATGCAGG + Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998648112 5:144086629-144086651 CTTTTTAAGGGAAAGAATAATGG + Intergenic
998708973 5:144799321-144799343 ATGTGTAAGGGCAGGAATCAGGG - Intergenic
999031499 5:148298012-148298034 CTGTGCAAGAGACAGAATGATGG - Intergenic
999659010 5:153839291-153839313 CTGTGAATTGGGGAGAATGATGG + Intergenic
1001824290 5:174733190-174733212 CTGTGTTAGAGGAGCAATGAGGG - Intergenic
1002294251 5:178221255-178221277 TTGTGTAAGGGGAACAACAAAGG - Intronic
1003062429 6:2874217-2874239 ATTTGTAAGTGGCAGAATGAGGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003812927 6:9804752-9804774 ATGTTTCAGGAGAAGAATGACGG - Intronic
1004063258 6:12218741-12218763 CTGTGTAGGGTCAAGAATGGAGG - Intergenic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1004722748 6:18282219-18282241 CTGTATAAAGGGAATAATAATGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1009281262 6:61754596-61754618 CTATGTAAGGTGGAGAATCAAGG - Intronic
1010291183 6:74139968-74139990 GTTGGAAAGGGGAAGAATGATGG - Intergenic
1010536751 6:77040125-77040147 CTATGTAAGGGTGATAATGAAGG - Intergenic
1011002583 6:82607586-82607608 CTGTAAAATGGGAATAATGATGG - Intergenic
1012409689 6:98942821-98942843 CTTATTAATGGGAAGAATGAGGG + Intronic
1013058507 6:106608985-106609007 CAATGTAGGGGGAAGAATTAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1016071606 6:139746116-139746138 CTGTGTGACTGAAAGAATGAAGG + Intergenic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017758606 6:157550931-157550953 CCATGGAAGGGGAAGGATGATGG + Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1019037311 6:169072526-169072548 CTGTGCAAGGGAAACAATGTGGG - Intergenic
1019125424 6:169837520-169837542 ATGTGTAGTGGGAAGAATAATGG + Intergenic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1022637768 7:32153453-32153475 GTGTGGATGGAGAAGAATGAAGG + Intronic
1024551530 7:50566400-50566422 CTTGGTAAGGGGAAGAGTGAGGG + Intergenic
1029883057 7:103837149-103837171 ATATGCCAGGGGAAGAATGATGG - Intronic
1029911795 7:104159606-104159628 CTGTGTGAGGGGCACAGTGAAGG - Intronic
1032546623 7:132749162-132749184 GTGAGTGAGGGCAAGAATGATGG - Intergenic
1035741331 8:1930410-1930432 CAGTAGAAGCGGAAGAATGAAGG - Intronic
1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG + Intronic
1036622534 8:10434252-10434274 CTGTGAAAGAGTAAAAATGAGGG + Intergenic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1040407294 8:47118121-47118143 GTGTTTAAGGGGAAGAGTGGTGG + Intergenic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041706293 8:60849729-60849751 CTGACTAAAGGGGAGAATGATGG + Intronic
1042865050 8:73349548-73349570 CTTTGTGAGTGAAAGAATGAAGG - Intergenic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1046812288 8:118546085-118546107 CTGTGTGAAGGCAGGAATGATGG - Intronic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1050354595 9:4770729-4770751 CTGTGTGAGGTGAAGATTGGAGG - Intergenic
1051165876 9:14261566-14261588 GTGTGCAAGGGGGAGAATGCAGG + Intronic
1051605634 9:18915433-18915455 CTGTGGAAGGGGCCAAATGAGGG - Intergenic
1052104004 9:24488779-24488801 CTGGGAAAGGGGAAAAAAGATGG + Intergenic
1053440077 9:38108838-38108860 CTGAGGAAGGGGAAAAATGGTGG + Intergenic
1055032660 9:71786175-71786197 CAGTGAAAGGGAATGAATGAAGG - Intronic
1055087723 9:72331339-72331361 TAGGGTAAGGGAAAGAATGAAGG - Intergenic
1055164785 9:73177840-73177862 TTGTGAATGTGGAAGAATGAAGG - Intergenic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056469297 9:86889751-86889773 CTGGGGAATGGGAATAATGAAGG - Intergenic
1057417182 9:94874960-94874982 CTGTGTAAGGGGCTCAAGGATGG + Intronic
1059663553 9:116425022-116425044 CTGTGCTAGAGGAAGAATGGAGG - Intergenic
1060055723 9:120411290-120411312 CTGTGTCATGGAAAGAATGCAGG - Intronic
1061238433 9:129355371-129355393 CTGTAAAATGGGAAGAATAATGG - Intergenic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1189648708 X:43164556-43164578 CTTTGTAAAGAGAAAAATGAAGG + Intergenic
1190739583 X:53280322-53280344 GTGGGTAAGGGGAACACTGAAGG + Intronic
1192364185 X:70457298-70457320 GAGTGTAAGGGAAAGAAAGATGG + Intronic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1196111607 X:111952559-111952581 CTTTGTAAGCGGAAAAAAGACGG - Intronic
1197576086 X:128213189-128213211 CTGTGTTCTGTGAAGAATGATGG - Intergenic
1198971101 X:142281300-142281322 CTATGTAAGGGGACAGATGAGGG - Intergenic
1199837866 X:151611490-151611512 CTGTGTAGGAGGCAGAATAATGG + Intronic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic