ID: 1181781193

View in Genome Browser
Species Human (GRCh38)
Location 22:25194748-25194770
Sequence CTGTGGTGCTGGAGGAGACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 1, 2: 5, 3: 58, 4: 439}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181781193_1181781202 22 Left 1181781193 22:25194748-25194770 CCTTGTCTCCTCCAGCACCACAG 0: 1
1: 1
2: 5
3: 58
4: 439
Right 1181781202 22:25194793-25194815 AGAGCGACCCTCTTTCACGTGGG 0: 1
1: 0
2: 1
3: 1
4: 49
1181781193_1181781201 21 Left 1181781193 22:25194748-25194770 CCTTGTCTCCTCCAGCACCACAG 0: 1
1: 1
2: 5
3: 58
4: 439
Right 1181781201 22:25194792-25194814 AAGAGCGACCCTCTTTCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1181781193_1181781199 -5 Left 1181781193 22:25194748-25194770 CCTTGTCTCCTCCAGCACCACAG 0: 1
1: 1
2: 5
3: 58
4: 439
Right 1181781199 22:25194766-25194788 CACAGGGAAGACAATCACAGTGG 0: 1
1: 0
2: 2
3: 29
4: 292
1181781193_1181781200 -4 Left 1181781193 22:25194748-25194770 CCTTGTCTCCTCCAGCACCACAG 0: 1
1: 1
2: 5
3: 58
4: 439
Right 1181781200 22:25194767-25194789 ACAGGGAAGACAATCACAGTGGG 0: 1
1: 0
2: 1
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181781193 Original CRISPR CTGTGGTGCTGGAGGAGACA AGG (reversed) Exonic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900430178 1:2597651-2597673 CTGGGGTGAGGGTGGAGACAAGG - Intronic
900792926 1:4691571-4691593 CCCTGGTGCTGGAGGAGAGTCGG + Intronic
900856568 1:5190009-5190031 CTGTGGTGCTGAAGAATGCATGG - Intergenic
901023735 1:6268287-6268309 CTGTGGTGGGGGAGTAGTCAGGG + Intronic
901215989 1:7555691-7555713 CCTTGGTGCTGGGGGAGACAGGG - Intronic
901536019 1:9883443-9883465 CTGTGGGGCCTGAGTAGACATGG - Intronic
901540283 1:9910736-9910758 CTGTGCTCCTGGAGCAGATAGGG - Intergenic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901737091 1:11319526-11319548 CTGGGGGGTTGGGGGAGACAGGG + Intergenic
902035044 1:13451783-13451805 CTGAGTTGCTGGAGGAGCCTAGG - Intergenic
902368229 1:15990810-15990832 CTGTGGGGCCGGAGGAGCCAGGG + Intergenic
902835453 1:19044163-19044185 CTCTCCTGCTGGAGGGGACAGGG - Intergenic
902835593 1:19044799-19044821 CTCTCCTGCTGGAGGGGACAGGG + Intergenic
903072064 1:20731557-20731579 CTGGGGTGGTGGAGGCGGCATGG + Intronic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904058007 1:27685207-27685229 CTTTGGTGCCCAAGGAGACAGGG + Intergenic
904783964 1:32971763-32971785 CTGTGGTATTGGAGGTGCCAAGG - Intergenic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905244331 1:36602315-36602337 CTGTGGTGGGGGTGGGGACAGGG - Intergenic
905488614 1:38326000-38326022 AGGTGGTGCTGCAGGAGGCAGGG + Intergenic
905786156 1:40759360-40759382 CTGATGTTCTGGTGGAGACAAGG - Intronic
905954030 1:41977279-41977301 TTGTGGAGTTGGAGGAGCCATGG - Intronic
908795009 1:67822348-67822370 CTGTGGTCCTGTATCAGACATGG - Intronic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
910998996 1:93142250-93142272 CTTTTTTGCTTGAGGAGACATGG + Intergenic
913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914018701 1:143844984-143845006 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914263934 1:146021674-146021696 CTGGGGACCTGGGGGAGACACGG - Exonic
914461507 1:147889997-147890019 TTGTGGTGCTGTGGGAGACAGGG + Intergenic
914657254 1:149753187-149753209 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914783424 1:150806659-150806681 CTGGGGTCCTGGAGGGGGCATGG - Intronic
915146922 1:153800852-153800874 CTGGGGTCATGGAGGAGACTGGG - Intergenic
915364284 1:155305591-155305613 TTGTGGTGTTGGCAGAGACATGG + Intergenic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918146261 1:181758624-181758646 GTGTGGTACAGGAGGAGAGATGG - Intronic
920097484 1:203496037-203496059 CCTTGGTGCTGCAGGAGACAGGG + Exonic
920521825 1:206633563-206633585 CTTGGGAGCTGGAGGGGACAGGG + Intergenic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923282314 1:232455785-232455807 CTGTGTTGCTGCAAAAGACATGG - Intronic
924490767 1:244535525-244535547 CTGTGGTGGTGGTGGCCACAGGG - Intronic
924627780 1:245710123-245710145 GCGTGGTGCAGTAGGAGACAGGG - Intergenic
1064707287 10:18086205-18086227 CTGTGGTGTTGGAGCAGGAATGG + Intergenic
1068885767 10:62095313-62095335 CGGTGGTTCTGCAGCAGACATGG + Exonic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069211553 10:65767588-65767610 CTTTGGTGTTGGAGGATAAAAGG + Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1070764218 10:79047310-79047332 CTGGGCTGCTGGAGGAGTCCAGG + Intergenic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1073927955 10:108538879-108538901 TTGTGGTGCTGGTAGAGACAAGG - Intergenic
1074100864 10:110354044-110354066 CTGGGGGGGTGGATGAGACAAGG + Intergenic
1074120063 10:110487505-110487527 CTCTGCAGCTGAAGGAGACAGGG - Intergenic
1074390088 10:113049862-113049884 TTGTGCTGGTGGAGGAGAGATGG + Intronic
1075516705 10:123114634-123114656 GTGTGTTGCGGGAGGGGACAGGG - Intergenic
1075763655 10:124875911-124875933 CTCTGGCACTGGAGGAGAAAGGG - Intergenic
1075797939 10:125134626-125134648 CTGTGGTGCGGGGGCAGAAAAGG - Intronic
1076121352 10:127939535-127939557 CAGGTGTGCTGGAGGATACATGG + Intronic
1076182349 10:128419922-128419944 CTGTGGTGATTGAGAATACACGG - Intergenic
1076371425 10:129958627-129958649 CCGCGGTGCCGGAGGAGTCAGGG - Intronic
1076553542 10:131304940-131304962 GTGGGCTGCTGGAGGAGACGTGG - Intronic
1076847420 10:133076152-133076174 CTGTGATGCTGGGGGAGTGAGGG - Intronic
1076863750 10:133157133-133157155 CTGTGGCTCTGGCGGAAACACGG - Intergenic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077150936 11:1072910-1072932 CTGTGGTGGTGGAGGCGATGGGG - Intergenic
1077508515 11:2943181-2943203 CTGAGGTCCTGGGGGAGACCAGG + Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1077782993 11:5352182-5352204 CATTGGTTCTGGAGGAGAAAGGG + Exonic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078807608 11:14721768-14721790 CTGTGGTGCGGGTGGGGGCAGGG + Intronic
1079029566 11:16976397-16976419 GAGGGGTGCTGGAGGAAACAAGG - Intronic
1079485135 11:20928234-20928256 CTGTGGTCCTGGAGTGGACTGGG + Intronic
1080250760 11:30230363-30230385 GGGTGGTGTTGGAGGAGGCAGGG + Intergenic
1081693223 11:45092348-45092370 CTGGGGTCCTGGAGGAGTCAGGG - Intergenic
1082757912 11:57096390-57096412 GTGGGGTGGTGGAGGAGAGATGG + Intergenic
1083088090 11:60170697-60170719 CTGTGGTGGTGGTGAAGACATGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083827116 11:65210175-65210197 CTGGGGTGCTAGTGGTGACATGG + Intronic
1084403233 11:68956696-68956718 CTGGGGTGATGGAGGAGGCTAGG - Intergenic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1085385956 11:76158529-76158551 GTGTTGAGCAGGAGGAGACAGGG - Intergenic
1085450651 11:76630131-76630153 CTGGGGTCCTGGAGAAGACAAGG - Intergenic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088205364 11:107386604-107386626 GTGTGGTGTTTCAGGAGACAGGG - Intronic
1089952854 11:122546367-122546389 CTGTTCTGGTGGAGGTGACAAGG + Intergenic
1090977119 11:131687860-131687882 GTGTGGGGCTGGAGGATACGTGG - Intronic
1091014655 11:132039152-132039174 CAGTGCTGCTGGAGAAGGCAAGG - Intronic
1091024859 11:132133150-132133172 ATATGGTGCTGGGAGAGACATGG - Intronic
1091115066 11:133005135-133005157 CAGTGGTGCAGGAGCAGGCAGGG - Intronic
1091422914 12:359159-359181 CTGTGGTGCTGGATTAGAGCTGG + Intronic
1091771912 12:3157666-3157688 CTGTCCTGCTGGAGGTCACAAGG + Intronic
1091903404 12:4163981-4164003 CTGTGGAGCTGAAGGAGACAAGG + Intergenic
1093588564 12:20872152-20872174 CTGTGGTGGTGGTGGACACAGGG - Intronic
1093974290 12:25403863-25403885 CTAGGGTACAGGAGGAGACATGG + Intergenic
1093991161 12:25591384-25591406 CTGTGGTGGTGGTGGCCACAGGG + Intronic
1094600770 12:31907065-31907087 CTGTGGTGTTGCAGGAATCAAGG - Intergenic
1095370002 12:41455929-41455951 ATGTGGTGGTTGAGGGGACAGGG - Intronic
1095808092 12:46343252-46343274 TGGTGGTGCTGGTGGACACAGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096892463 12:54785838-54785860 CCCTGCTGCTGGAGGGGACAGGG + Intergenic
1097100790 12:56587637-56587659 CTGTGCTGCTGAGGGAGAGATGG - Exonic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097275151 12:57808072-57808094 CTGAGGTGCCGGAGGGGAAAGGG + Intronic
1098250158 12:68560805-68560827 CTGTGGCACTGGAGGAGGCTAGG + Intergenic
1098333929 12:69382463-69382485 CTGTGGTAGTGGTGGACACAGGG - Intronic
1099094788 12:78360623-78360645 TTATAGTGCTGGAGGAGAGAAGG - Intergenic
1099218272 12:79879947-79879969 ATGTGGAGCTTGAGGAGGCAAGG - Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1104606253 12:130191216-130191238 CTGTGGAGCACTAGGAGACAGGG - Intergenic
1104666462 12:130650538-130650560 ATGTGCTGCTGGAGGGGACACGG - Intronic
1105838672 13:24233837-24233859 CAGCAGTGCTGGAGGAGACTCGG - Intronic
1108636145 13:52336588-52336610 CTGTAGTGCTGGAGTACACCAGG - Intergenic
1108651665 13:52486664-52486686 CTGTAGTGCTGGAGTACACCAGG + Intergenic
1109787817 13:67204389-67204411 CTGAGGTGATGTAGTAGACAAGG - Intronic
1110408991 13:75183787-75183809 CTGAGGTACTGCAGGAGACCAGG - Intergenic
1110782089 13:79478349-79478371 CTGCAGTACTGGAGTAGACATGG - Intergenic
1112044446 13:95582116-95582138 CTGTGTTGCTGTGGGAAACACGG + Exonic
1113704962 13:112424197-112424219 CAGAGATGCTGGTGGAGACAGGG - Intronic
1114152860 14:20064305-20064327 CTCTGGTGCTGCAGCAGAGAAGG - Intergenic
1115868819 14:37777980-37778002 CTGCTGTGCTGGAGGGGCCAAGG + Intronic
1116043731 14:39717468-39717490 CTCTGGTGCTGAAGTGGACACGG - Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116962186 14:50977912-50977934 CTCTTGGGCTGGAGAAGACAGGG - Intronic
1117305929 14:54473089-54473111 CTGTGGTGCTTCAGAACACAGGG - Intergenic
1117440972 14:55758893-55758915 GTGTGGTGCTGGTGAACACAGGG + Intergenic
1118158649 14:63266893-63266915 CTGTGGAGCTGGATCAGAAAAGG - Intronic
1118168843 14:63364971-63364993 CTGTGGTGCTGGATTAGAGTTGG + Intergenic
1118865656 14:69701654-69701676 CTCTGGTGGTGGAGGAGAATAGG + Intronic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1121664988 14:95665559-95665581 CAGGGCTGCTGAAGGAGACATGG - Intergenic
1122602290 14:102927916-102927938 CAGGGGTGCAGGAGGAGGCAGGG - Intronic
1122806355 14:104261603-104261625 CTGTGCTGCTGGGGGAGGCAGGG + Intergenic
1124048317 15:26171876-26171898 CAGTGATGGTGGAAGAGACAGGG - Intergenic
1124813553 15:32965968-32965990 CTGTGGTGCTGGGGGAGACGGGG + Intronic
1125889988 15:43258710-43258732 CTGTGGTGCTGCAGGACAGGAGG - Intronic
1126015730 15:44348439-44348461 CTGTGGTAGTGGTGGACACAGGG + Intronic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1126585032 15:50276743-50276765 ATGTGGTGCTGGAGCAGAGAAGG - Intronic
1127394956 15:58537241-58537263 CTGTGGTGCTGCACCAGAGACGG - Intronic
1127582830 15:60353337-60353359 CTGTTGTGGTGGGGGAGAAAGGG - Intronic
1128087823 15:64897917-64897939 CTGTGGAGCTGGAGCCAACAGGG - Intronic
1128705960 15:69837618-69837640 CTGGGATGCTGGAGGGGTCAGGG + Intergenic
1128997797 15:72309604-72309626 CAGTGGTGATGGAGGACACCTGG + Intronic
1129468303 15:75736591-75736613 CTGTGCTGCTCATGGAGACAGGG + Intergenic
1129708394 15:77807603-77807625 CTGTGGTCCTGGGAGAGAAATGG - Intronic
1130157488 15:81364183-81364205 CAGTAGTGCTTGAGGAGCCAGGG + Intronic
1130356027 15:83131083-83131105 TTGTGGTGGTGGGAGAGACAGGG - Exonic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132755966 16:1485692-1485714 CCGTGGTGATGGAAGAAACATGG + Intergenic
1132805115 16:1771699-1771721 CCGAGCTGCTGGAGGAGACTTGG - Exonic
1132929329 16:2450977-2450999 CAGTGGGGCTGGGGCAGACAGGG - Intronic
1134179668 16:12037321-12037343 CTCAGCTCCTGGAGGAGACAAGG + Intronic
1134594589 16:15485658-15485680 CTGTGTTACTGGAGGAAACTGGG + Intronic
1135232412 16:20721530-20721552 CTGTAGTGCTGGAGCAGAGTAGG + Intronic
1135306411 16:21371090-21371112 CTCAGCTCCTGGAGGAGACAAGG + Intergenic
1136061870 16:27732205-27732227 CTGTGATGCTGGGTGGGACACGG + Intronic
1136303155 16:29350234-29350256 CTCAGCTTCTGGAGGAGACAAGG + Intergenic
1136418106 16:30115667-30115689 TTGTGGGGCTGGAGGATGCAAGG + Intronic
1136428478 16:30184149-30184171 CTGTGGTGGGGGAGGAGGCAGGG + Intronic
1137253665 16:46758112-46758134 CTGCAGTGCAGGAGAAGACAAGG + Intronic
1137393782 16:48102778-48102800 GTGTGGTGCAGGAGGAGAAGCGG - Intronic
1137934052 16:52616967-52616989 CAGTGGTGCTGGAGAACATATGG - Intergenic
1138228611 16:55322038-55322060 CTGGGAAGCCGGAGGAGACATGG + Intergenic
1138419496 16:56890078-56890100 CTGTAGAGCTGGAGGAGTCCTGG + Intronic
1138756922 16:59498408-59498430 CTGTGGTGCTGGATTAGAACTGG - Intergenic
1138867242 16:60836878-60836900 GTGTGGTCCTGGAGTACACATGG + Intergenic
1139591585 16:67936078-67936100 CTGTGGGGCTGGAGTAGCCGCGG - Exonic
1139633709 16:68245542-68245564 CAGTGGTGCTGGGTGAGGCACGG + Exonic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1141984288 16:87570145-87570167 CTGGGGGGCGGGAGGGGACAAGG + Intergenic
1142422713 16:89982339-89982361 CAGGGGTGCAGGAGGGGACACGG - Intergenic
1142854366 17:2721727-2721749 CTGAGGTGCTGGAGGTGCCTGGG - Intergenic
1142982778 17:3681095-3681117 CTGTGCTGCTGAAGGAAGCAGGG - Intronic
1143443725 17:6995537-6995559 CTCAGGTACTGGAGGACACATGG + Intronic
1143539468 17:7560641-7560663 CGGTGGAGCTGGAGAAGGCAGGG + Intronic
1144008456 17:11122743-11122765 CTGGGGTGATAGAGGACACAGGG + Intergenic
1144447422 17:15343987-15344009 CTTTAGTGCTGGAGGAGAAATGG - Intergenic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1145123053 17:20277984-20278006 CTTTGGTTCTGGAAGACACAAGG - Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1146892587 17:36515608-36515630 CAGTCGTGCTGGAGAAGACCTGG - Intronic
1147419608 17:40315956-40315978 CTCTGATGCAGGAGGAGAGAAGG - Intronic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148442747 17:47720283-47720305 CTGTGATGCTAGAGAAGAAAGGG + Intergenic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1148865149 17:50624428-50624450 CTGTGGGGCTGGAGCAGATGAGG - Exonic
1150098346 17:62399079-62399101 ATTTGGTGCTGTAGGAGTCAAGG - Intronic
1151199565 17:72457802-72457824 CTCAGGAGCTGGAGCAGACATGG - Intergenic
1151305378 17:73259778-73259800 CTGGGGGGCTGGAGGGGACCAGG - Intronic
1151915754 17:77116850-77116872 CTGCAGTGGTGGATGAGACAGGG - Intronic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152080604 17:78185161-78185183 CTGTGCTGCAAGAGGAGAGAGGG + Exonic
1152253943 17:79226565-79226587 CTGTGGAGCAGGAGGAGCCTGGG + Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1153226109 18:2901265-2901287 CTGGGCTGCAGGAGGAGACCTGG - Intronic
1153571353 18:6476400-6476422 CTCTTGTGCTGCAGGAGATAAGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154120962 18:11652179-11652201 CTGTGGTGCTGGTGGGGTCCTGG + Intergenic
1154973472 18:21433858-21433880 CTGTTCTGCTGGAGTAGTCAGGG + Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1156378237 18:36533496-36533518 TTGTGGTGCTGTAGGTGGCATGG + Intronic
1156396619 18:36705103-36705125 CTGTGATGCAGGTGGAGACAGGG + Intronic
1157237528 18:45978567-45978589 TTGTGGTGCTGGCTGAGGCAAGG - Intergenic
1157475251 18:48019872-48019894 ATGTGGTGATGGGGGAGAGATGG + Intergenic
1158341575 18:56472307-56472329 CTCTGATGCCAGAGGAGACACGG - Intergenic
1158408801 18:57186440-57186462 CTCTGCTGGTGGAGGAGGCAAGG + Intergenic
1159189333 18:65021418-65021440 CTGTGTTGCTGCAAAAGACATGG - Intergenic
1160508032 18:79438074-79438096 CTGTGGTCCCGGAGGAGACCTGG + Intronic
1160854232 19:1208990-1209012 CTCTGGAGCTGGAGCAGTCAGGG + Intronic
1161065562 19:2235821-2235843 CCGACGGGCTGGAGGAGACACGG + Exonic
1161639449 19:5411850-5411872 CTGTGTTTTTGGTGGAGACAGGG - Intergenic
1161694575 19:5758986-5759008 ATGGGGTGTTGGAGGGGACATGG - Intronic
1162060224 19:8090308-8090330 CTGGGGTGCGGGAGGTCACAGGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163640758 19:18460807-18460829 CTGTGGTGGAGGAAGAGACATGG - Intronic
1164188261 19:22891989-22892011 CTGTGGTGCTGGACCAGATTTGG - Intergenic
1164618889 19:29682163-29682185 CTGTGCTGCTGCGGGAGACAGGG - Intergenic
1165245545 19:34496560-34496582 CTGAGCAGCTGGAGGAGTCAGGG + Intronic
1165277826 19:34770328-34770350 CTGTGGTGATGGAGGAGTACAGG - Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1167701864 19:51053310-51053332 CTGGGTTACTGGTGGAGACAAGG - Intergenic
925409987 2:3634454-3634476 CTTTGCTGCAGGAGGAGGCACGG - Intronic
926073800 2:9923899-9923921 CTCTGCAGCTGGAGGAGGCAGGG - Intronic
926406168 2:12555122-12555144 CAGTGGTGTGGGAGGAGCCATGG + Intergenic
926994640 2:18721270-18721292 TAGTGGTGCAGGAGGAGGCAGGG - Intergenic
927090705 2:19708784-19708806 ATGTGATGCAGGAGGAGCCATGG + Intergenic
927208881 2:20626744-20626766 TTGTGGTGCTGGAGGTGAGGTGG + Intronic
927784746 2:25965910-25965932 CTGTGGGGGTGGAAAAGACAGGG + Intronic
928081937 2:28319610-28319632 CAGTGTTGCTGAAGGAGACAGGG - Intronic
928656296 2:33455041-33455063 ATGTGGTGATGGAGGAGAGTGGG + Intronic
929918640 2:46156464-46156486 CTGTGGTGAGTGATGAGACACGG - Intronic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931243969 2:60477693-60477715 CAGTGGTGCTGTGAGAGACAAGG + Intronic
931458007 2:62427053-62427075 CGATGGGGCTGGGGGAGACATGG + Intergenic
933634939 2:84698563-84698585 CTGATGTGATGGAGGACACATGG - Intronic
934526954 2:95057911-95057933 CTGGGGCGCTGGAGCAGACACGG + Intergenic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935209961 2:100931057-100931079 CTGTGGTGCTGGCTGAGGCAAGG - Intronic
935331759 2:101982490-101982512 CTGTGCAGCTGGAGGACACCAGG + Intergenic
936573843 2:113637363-113637385 CAGTGGTGCAGGAGCACACACGG - Intronic
936594324 2:113833353-113833375 CTGAGTTGCTGGAAGAGAGAGGG - Intergenic
938598205 2:132811154-132811176 CTGTTCTGGTGGAGGCGACAGGG + Intronic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
942861018 2:180612205-180612227 ATGTGCTTCTGGAGGAGACAGGG + Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
945671606 2:212809024-212809046 ATGTGGTGCTGGAGTAGTCATGG - Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947532933 2:230924221-230924243 CTGTGGAGCTGCAGCAGACCTGG - Intronic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
947731707 2:232434976-232434998 CTGTGGTGTTGGGGGAGATGAGG - Intergenic
1169430241 20:5530038-5530060 CTGGGGTGGTGGAGAAGACCTGG - Intergenic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1172315953 20:33954620-33954642 GTGAGGTGCTGGAAGAGACAGGG - Intergenic
1172359011 20:34299326-34299348 CTGTGCTGCTGGTAGAAACATGG - Intronic
1172877366 20:38173436-38173458 ATGTGGGGCTGCTGGAGACACGG + Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173447460 20:43132682-43132704 CTGTAATGCAGGAAGAGACAAGG + Intronic
1173742757 20:45413004-45413026 CTGTGGTTCGGCAGGAGAAAAGG - Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175504390 20:59471204-59471226 CTGTCGTGTTGGAGGGGGCACGG + Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1175883556 20:62274534-62274556 CTGTGGTTCTGAAGGAGGGAGGG + Intronic
1175929298 20:62486063-62486085 CCATGGTGCTGGAGGTGCCAGGG - Intergenic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1177809141 21:25906026-25906048 CACAGGTGCTGAAGGAGACACGG + Intronic
1178643526 21:34365867-34365889 CTGTGGTCATGGAGCAGGCATGG + Intronic
1179364362 21:40742415-40742437 CTGTAGGGCTGGAGAAGCCAAGG + Intronic
1179836085 21:44034410-44034432 CTGAGGTGCTGCAGAAGGCAAGG + Intronic
1180098358 21:45572254-45572276 ATGGGGGGCTGGAGGAGGCAAGG + Intergenic
1180216645 21:46327825-46327847 GTGTGTTGCTGGAGGAGACTGGG + Intronic
1180225431 21:46389199-46389221 CTCCGGCGCTGGAGGAGACATGG + Exonic
1180225527 21:46389900-46389922 CTCTGGCGCTGGAGGAGATGTGG + Intronic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1182240389 22:28911377-28911399 CCATGCTGCTGGAGGACACAGGG - Intronic
1182257291 22:29048440-29048462 GTGTGGTGCTGCAGCAGCCAGGG - Exonic
1182474827 22:30571329-30571351 ATGGGGTGCTGGAGCAGAGAGGG + Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184231146 22:43159133-43159155 CGGGGATGCTGGAGGAGACACGG + Intronic
1184235469 22:43180775-43180797 CCCTGGTGCTGGAGGAGATGTGG - Exonic
1184473460 22:44708514-44708536 CGGTGTTGCTGGGGGAGACACGG - Intronic
1184615169 22:45633038-45633060 CTGTGGGGGCGGGGGAGACAGGG + Intergenic
1185210690 22:49569055-49569077 CTGAGGTGCAGGAGGAGCCGGGG - Intronic
1185311508 22:50158258-50158280 CTGTGGAGCTGCAGGAGCCAAGG - Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950496489 3:13337193-13337215 CTGTGCTGCTGGGGGACCCATGG - Intronic
950627511 3:14259079-14259101 CTGCGGGGCTGGTGGAGGCAAGG - Intergenic
951708752 3:25568939-25568961 CTGTGCTGCAGGAGGAAGCACGG + Intronic
952210185 3:31222471-31222493 CTGTGGTGCAGAAGGAGGGAGGG - Intergenic
953124633 3:40078835-40078857 CCGTTCTGCTGAAGGAGACAGGG + Intronic
953391187 3:42534802-42534824 CTGTGGAACAGGAGCAGACAAGG + Intronic
954104382 3:48401829-48401851 GGGTGGTGCTGGGGGATACAGGG - Intergenic
955585606 3:60474179-60474201 CTTTGGTGCTGGTGCAGTCAGGG - Intronic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
957497439 3:81009350-81009372 CTATGGTGGTGGAGCAGTCATGG + Intergenic
958183868 3:90093894-90093916 CTGTATTGTTGGAGGAGAAAAGG - Intergenic
958460121 3:94383768-94383790 CTGCCATGCTGGAGGGGACAAGG - Intergenic
960688160 3:120314357-120314379 CTATTGTGCTGGAGGGGCCAAGG - Intergenic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
961253966 3:125530942-125530964 CTGGGGTGCCAGTGGAGACAGGG - Intronic
962381163 3:134899103-134899125 GTGGGGTGGAGGAGGAGACATGG + Intronic
963051134 3:141144965-141144987 GGGTGTTGCTGGAGGAGAGATGG + Intronic
964179457 3:153865702-153865724 CAGTGGTGGTGGTGGACACAGGG + Intergenic
964568811 3:158089991-158090013 CTTTGAAGCTGGAGGAGGCAGGG - Intergenic
965840641 3:172901900-172901922 GTATGGTGTTGGAGGAGACCTGG - Intronic
967203938 3:187102107-187102129 GTGTGGTGGGGGAGGAGAAATGG + Intergenic
967313315 3:188127127-188127149 AGGTGGGGCTGGAGGTGACAGGG - Intergenic
968707317 4:2085977-2085999 ATGTGGTGATGAAGTAGACATGG + Intronic
968726746 4:2251389-2251411 CTGTGGGGCTGGCAGAGACTGGG - Intronic
969310949 4:6353015-6353037 CCCCGGAGCTGGAGGAGACAAGG + Intronic
969719465 4:8885298-8885320 CTGTGCTGCCAGAGGGGACAGGG + Intergenic
969841970 4:9889300-9889322 GTGGGGCACTGGAGGAGACAAGG + Intronic
969904158 4:10377724-10377746 CTGTGTTCCTGAAGGAAACAGGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
972254406 4:37337627-37337649 CTGTGCTGCCCAAGGAGACAAGG - Intronic
972603643 4:40594159-40594181 CAGTGCTGGTGGAGGAAACAGGG - Intronic
973834213 4:54792866-54792888 CTGTGGTGATGAAAGTGACAGGG - Intergenic
974466970 4:62270473-62270495 CTGTGGTTCTAGATGAGACTTGG - Intergenic
975369450 4:73568014-73568036 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
976451814 4:85199396-85199418 CTGTGGTGGTGGTGGATACAGGG - Intergenic
977953808 4:103003724-103003746 CTGCTGTGCTGCAGGAGCCAAGG - Intronic
978934552 4:114359260-114359282 CTGTGTTGGTGGTGGACACAGGG - Intergenic
979210974 4:118102359-118102381 CTGTGGTCATGGAGGAGGTAAGG - Intronic
979777491 4:124609251-124609273 CTTTGTTACTGGTGGAGACAGGG - Intergenic
980429456 4:132673292-132673314 CTGTGGTACTGTAGAAGAAAGGG + Intergenic
981358020 4:143814091-143814113 CTGTGGAACTGGAGTAAACATGG - Intergenic
981369265 4:143940202-143940224 CTGTGGAACTGGAGTAAACATGG - Intergenic
981379010 4:144050144-144050166 CTGTGGAACTGGAGTACACATGG - Intergenic
982132475 4:152243038-152243060 CTGTGCTGCTGGTGGAGATACGG - Intergenic
985091323 4:186365110-186365132 ACGTGGTGATGGAGGAGAGAGGG - Intergenic
986300589 5:6475710-6475732 GGGTGGTGCTGGAGGAGGCAGGG + Intronic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986995303 5:13601059-13601081 CTGTGATCCTGTAGTAGACATGG - Intergenic
987018347 5:13844108-13844130 GTGCTGTGGTGGAGGAGACAGGG - Intronic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
989277795 5:39610033-39610055 CTTTGCTGCTGGAGCAGAGAAGG + Intergenic
989560090 5:42840652-42840674 CAGTGGTGGTGTAGGAGGCATGG - Intronic
990719105 5:58673236-58673258 CTGTGGTGCTGAATGATGCAGGG - Intronic
990899999 5:60739544-60739566 CTGTGGTGGTGGTGGACACAGGG + Intergenic
991237805 5:64419267-64419289 CTGTGGTGGTGGTGGCCACAGGG + Intergenic
992955884 5:81907616-81907638 TTCTGGGGCTGGAGGAAACAAGG + Intergenic
993117786 5:83737758-83737780 CTCAGGTGCTGGAGAGGACATGG - Intergenic
995188716 5:109298295-109298317 CTGAGGTGCTGGCTGGGACAGGG - Intergenic
995380422 5:111525597-111525619 ATGCGGCGCTGCAGGAGACAAGG + Intergenic
996031856 5:118714376-118714398 CTGTTCTGCTGGAGGTGGCAGGG - Intergenic
997566135 5:134887930-134887952 CTGTGGTGCTGGAGGAGCGGAGG + Exonic
998106382 5:139471748-139471770 CTGGGGTCCTGGAGGAGAGGGGG - Intergenic
998140843 5:139698632-139698654 GTGGGGTGCTTGAGGAGGCAGGG - Intergenic
998218340 5:140254524-140254546 CTGTGGTGGAGAGGGAGACAGGG - Intronic
998996305 5:147871904-147871926 CTGTAGTCCAGGAGTAGACAGGG + Intronic
999561403 5:152807532-152807554 AAGTGCTGCTGGAGGAGAGAAGG - Intergenic
1000159810 5:158586620-158586642 CTGTGGTGGTGGTGGCTACAGGG - Intergenic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1001870141 5:175146953-175146975 CTGAGGTTCTGCAGGAGACCAGG - Intergenic
1001886364 5:175293935-175293957 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1004696640 6:18040260-18040282 CAGTGGTGGTGATGGAGACAAGG + Intergenic
1005285311 6:24320263-24320285 CCGTGGTGCTGGAGTAGAACTGG + Intronic
1006009679 6:31032053-31032075 GTGTGGTGGGGGAGGAGAGATGG - Intronic
1006056118 6:31385664-31385686 CCCTGGTGCTGGAGGTGGCAGGG - Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007494686 6:42251766-42251788 TTGTGGAGATGGAGGAGACCTGG - Intronic
1007741252 6:44010897-44010919 CAGTGGGGCTGCTGGAGACAGGG - Intergenic
1007878984 6:45140656-45140678 CTGCTGTGCTGGAGGTGGCAGGG - Intronic
1007961849 6:45967286-45967308 ATGTGGTGATGAAAGAGACATGG + Intronic
1009392648 6:63163521-63163543 TTGTATTTCTGGAGGAGACAGGG + Intergenic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010317274 6:74466143-74466165 CTGCTGTGCTGGAGGGGTCAAGG + Intergenic
1010634114 6:78235323-78235345 CTGTGATTCTAGAGGTGACAAGG - Intergenic
1012138104 6:95584462-95584484 GTGGGGTACTGGAGGAGACCAGG - Intronic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013732125 6:113180783-113180805 CTGGGGTGCTGTAAGAGTCAAGG - Intergenic
1013823945 6:114188530-114188552 AAATGGTGTTGGAGGAGACAGGG - Intronic
1013865067 6:114686570-114686592 ATGTGGGGCTGGGGAAGACAGGG + Intergenic
1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG + Intergenic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016457321 6:144244849-144244871 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1016873781 6:148844557-148844579 CTGAGTGGCTGGAGCAGACAGGG - Intronic
1018066968 6:160131269-160131291 AGGTGCCGCTGGAGGAGACAGGG + Intronic
1018587953 6:165384001-165384023 CTGTAGTCCTGGAACAGACAGGG + Intronic
1018799780 6:167212928-167212950 CTGTGGTGCTGGATGGGGCCAGG + Intergenic
1019020318 6:168912597-168912619 CTTTGGTGCTGCAGGAGATGAGG - Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019426423 7:979404-979426 CTTATGTGCAGGAGGAGACAAGG + Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020603587 7:10307109-10307131 TTGGGGTGCTGCAGGAGACCAGG - Intergenic
1021576383 7:22109485-22109507 CTGTGGTCCTGGAAGAGCTATGG - Intergenic
1022448092 7:30486278-30486300 CTCTGGTGCTGCAAAAGACAAGG + Intergenic
1022741080 7:33122493-33122515 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1022877885 7:34553383-34553405 CTGTAGTGTTGGAGGGGCCAAGG - Intergenic
1023560856 7:41471816-41471838 CAGTGGTGATGGAGGACATATGG + Intergenic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1026840408 7:73667706-73667728 CTGGGGTGCTGGAGGCGGCGCGG + Intergenic
1026910601 7:74089681-74089703 GTGTTGAGCTGGAGGGGACATGG + Intronic
1026963477 7:74424566-74424588 ATGTGATGCTAGCGGAGACATGG + Intergenic
1027122318 7:75530700-75530722 GCGTGGAGCTGGAGTAGACAGGG - Intergenic
1027342045 7:77220094-77220116 CTGGGGCGCTGCAGGAGACCAGG + Intronic
1027554578 7:79647816-79647838 CTGCTGCGCTGGAGGAGTCAAGG + Intergenic
1027764267 7:82320416-82320438 CTGTGGTTTTGAGGGAGACAGGG + Intronic
1028742346 7:94290084-94290106 CTGTGTTGATGGATGAGTCAAGG + Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029203733 7:98855904-98855926 CTGTGGGGCTCCAGAAGACAGGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1031311724 7:120207285-120207307 CTGCTGTGCTGGAGGGGTCAAGG - Intergenic
1031761281 7:125716159-125716181 CTGTGCTGTTGGAGGGGACACGG - Intergenic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1032501601 7:132404039-132404061 CTGTGGTGGGCCAGGAGACAAGG + Intronic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032898029 7:136273949-136273971 GGGTGGTGCTGCAGGAGAGAAGG + Intergenic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1034264037 7:149772886-149772908 CTGTGGGGGTAGAGGAGACCGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035153708 7:156895267-156895289 CTGGGGTGATGGAGGTGACCAGG - Intergenic
1035626047 8:1071378-1071400 GGGTGGTGCTGGAGGAGGGAGGG - Intergenic
1035646118 8:1222446-1222468 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1035727223 8:1832056-1832078 CTGTGGGGCTGGAGGAGCAGCGG + Intronic
1036172259 8:6499179-6499201 GTTTGGTCCTGGAGGAGAGACGG + Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037272045 8:17141088-17141110 CTGTGGAGCTGGAGCAGAATGGG + Intergenic
1037281627 8:17247554-17247576 CAGTGGTGCGGCAGGAGGCAGGG - Intronic
1038742776 8:30230497-30230519 CTGTAGTCCTGTGGGAGACAAGG + Intergenic
1039144980 8:34437621-34437643 CAGTGCTGTTGGAGGGGACATGG + Intergenic
1039783961 8:40816025-40816047 CTGTGATGCTGGAGGAAATGTGG - Intronic
1039816483 8:41099253-41099275 GTGTGGCCCTGGAGCAGACAGGG - Intergenic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1040412012 8:47164106-47164128 TTGTGGGGTTGGAGGAGGCAGGG + Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1040893217 8:52338915-52338937 TTTTTGTGCTGGGGGAGACAGGG + Intronic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1041467620 8:58172815-58172837 CCGTGTAGCTGGAGGAGATATGG - Intronic
1042278485 8:67029572-67029594 CTGTGATTCTGGTGGAGAAAAGG + Intronic
1042300873 8:67279337-67279359 TTGTGGTGCTGCAAGAGACAGGG - Intronic
1046800631 8:118422884-118422906 CTGTGGTGTGGGAGGAGCAAGGG + Intronic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1048589090 8:135804423-135804445 CTCTGGTGTTGGTGGAGACGGGG + Intergenic
1048825240 8:138417598-138417620 CTGCTGTGTTGGAGGAGCCAAGG - Intronic
1048867880 8:138773960-138773982 CTCTGGTGCTGGAGGGAGCAGGG - Intronic
1049015751 8:139918847-139918869 CCGTGGTGCAGGAGGAGCCCAGG - Intronic
1049257052 8:141619780-141619802 GAGGGGTCCTGGAGGAGACAAGG - Intergenic
1049640619 8:143713512-143713534 CTGTGACACTGGAGGGGACAGGG + Intronic
1049752015 8:144289409-144289431 GTGTGGTCCTGGAGGCCACATGG - Intronic
1050075465 9:1858114-1858136 CTCTGCTGCTGGAGGGGGCAAGG - Intergenic
1050564806 9:6870909-6870931 CTGTGGTCCTGGATGTCACAAGG + Intronic
1051890194 9:21933483-21933505 CTCAGGTCCTAGAGGAGACAGGG - Intronic
1052386889 9:27833249-27833271 CTGTGGTTCTGGAATAGCCAAGG + Intergenic
1052501120 9:29291750-29291772 CTAGGGTGTTGGAGGAGATAGGG - Intergenic
1053160256 9:35809166-35809188 CCTTGGTGGTAGAGGAGACATGG - Exonic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1055428638 9:76220909-76220931 CTGTGGTGGTGGGGAAGACTGGG - Intronic
1056714878 9:89020782-89020804 CACTGCTGATGGAGGAGACATGG - Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057910311 9:99015272-99015294 GTGTGGTCCTGGAGGAGCAAAGG + Intronic
1058645438 9:107127548-107127570 CTGTGGTGCTGGGGGTTGCAGGG + Intergenic
1059526352 9:114994090-114994112 CTGTGGTGTTGGAGGAGGGGTGG + Intergenic
1060778307 9:126392855-126392877 CTGTGCAGCTGGAAGAGCCAGGG + Intronic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061681239 9:132243393-132243415 AAGGGGTGCTGGAGGGGACAGGG + Exonic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG + Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062408734 9:136410676-136410698 CTGTGGTGCTGGCGGCGACGCGG + Exonic
1062437433 9:136552768-136552790 TTGTGGTGGTGCAGCAGACATGG + Intergenic
1185449610 X:275393-275415 CTGGGGTGAGGGAGGAAACAGGG + Intergenic
1185736822 X:2501399-2501421 CTGTGGTCCTGGAGGAGGTGTGG - Intronic
1186593049 X:10951818-10951840 CTGTGTTGCTGGAGGAAATTAGG - Intergenic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1189926500 X:45960290-45960312 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1190777208 X:53562472-53562494 GGGTGGTGCTTGAGGAGCCATGG + Intronic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1192536646 X:71934113-71934135 CTTTGGTCCTGGAGGAGAACTGG - Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193449414 X:81647215-81647237 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1194479306 X:94400886-94400908 CAGTGGTGGTGGTGGATACAGGG - Intergenic
1195218207 X:102721272-102721294 CTGTGGTGCTGGATCAGGAAAGG + Intronic
1195803677 X:108737989-108738011 CTGGGGTGGTGGGGGAGAGAGGG - Intergenic
1196027324 X:111054789-111054811 CTGAGGTGATGGTGGAGGCAGGG - Intronic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196412189 X:115432001-115432023 TTGTGGTGCTGAAAGGGACATGG - Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1197518962 X:127473430-127473452 CTGTTCTGGTGGAGGTGACAGGG - Intergenic
1199191866 X:144980526-144980548 CTGTGCTGGTGGTGGAAACAAGG + Intergenic
1199642010 X:149871507-149871529 CTGGGATGCTGTAGGAGACATGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1201257399 Y:12122520-12122542 CTGAGGTCGTGTAGGAGACAAGG + Intergenic