ID: 1181783417

View in Genome Browser
Species Human (GRCh38)
Location 22:25208848-25208870
Sequence CAGTGGTCAGTGGGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181783417_1181783434 10 Left 1181783417 22:25208848-25208870 CCACCTCCCCCCACTGACCACTG No data
Right 1181783434 22:25208881-25208903 CCGTGGCTTCATCTGGGCAGTGG No data
1181783417_1181783435 11 Left 1181783417 22:25208848-25208870 CCACCTCCCCCCACTGACCACTG No data
Right 1181783435 22:25208882-25208904 CGTGGCTTCATCTGGGCAGTGGG No data
1181783417_1181783428 3 Left 1181783417 22:25208848-25208870 CCACCTCCCCCCACTGACCACTG No data
Right 1181783428 22:25208874-25208896 TGGGCCCCCGTGGCTTCATCTGG No data
1181783417_1181783426 -7 Left 1181783417 22:25208848-25208870 CCACCTCCCCCCACTGACCACTG No data
Right 1181783426 22:25208864-25208886 ACCACTGCTCTGGGCCCCCGTGG No data
1181783417_1181783429 4 Left 1181783417 22:25208848-25208870 CCACCTCCCCCCACTGACCACTG No data
Right 1181783429 22:25208875-25208897 GGGCCCCCGTGGCTTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181783417 Original CRISPR CAGTGGTCAGTGGGGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr