ID: 1181783701

View in Genome Browser
Species Human (GRCh38)
Location 22:25210469-25210491
Sequence ATGAAGAAACAGGCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181783694_1181783701 28 Left 1181783694 22:25210418-25210440 CCCTAAGAATGTCATTGGGAGGT No data
Right 1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG No data
1181783695_1181783701 27 Left 1181783695 22:25210419-25210441 CCTAAGAATGTCATTGGGAGGTA No data
Right 1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181783701 Original CRISPR ATGAAGAAACAGGCTCAGGG AGG Intergenic
No off target data available for this crispr