ID: 1181786599

View in Genome Browser
Species Human (GRCh38)
Location 22:25231638-25231660
Sequence CTGCAGTACCTGCTGGAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 2, 1: 0, 2: 3, 3: 35, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181786588_1181786599 18 Left 1181786588 22:25231597-25231619 CCTGCAGGTGGGTTGGCTACCAG 0: 1
1: 1
2: 3
3: 13
4: 114
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282
1181786592_1181786599 -1 Left 1181786592 22:25231616-25231638 CCAGTACCCCGGCTACCGTGGGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282
1181786587_1181786599 19 Left 1181786587 22:25231596-25231618 CCCTGCAGGTGGGTTGGCTACCA 0: 1
1: 1
2: 1
3: 13
4: 80
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282
1181786585_1181786599 26 Left 1181786585 22:25231589-25231611 CCTCTGGCCCTGCAGGTGGGTTG 0: 2
1: 0
2: 3
3: 24
4: 261
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282
1181786595_1181786599 -9 Left 1181786595 22:25231624-25231646 CCGGCTACCGTGGGCTGCAGTAC 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282
1181786593_1181786599 -7 Left 1181786593 22:25231622-25231644 CCCCGGCTACCGTGGGCTGCAGT 0: 1
1: 1
2: 2
3: 2
4: 80
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282
1181786594_1181786599 -8 Left 1181786594 22:25231623-25231645 CCCGGCTACCGTGGGCTGCAGTA 0: 2
1: 0
2: 1
3: 5
4: 112
Right 1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG 0: 2
1: 0
2: 3
3: 35
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181786599 Original CRISPR CTGCAGTACCTGCTGGAGAA GGG Exonic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
900997026 1:6128307-6128329 CTGCAGCCCCTGCTGGGGATGGG - Intronic
901009689 1:6192921-6192943 CTCCTGTACCTTTTGGAGAAAGG + Exonic
901380132 1:8867650-8867672 CTGTAGTCCCAGCAGGAGAATGG - Intronic
901414277 1:9106040-9106062 CTGCAGGACTTGCTGGGGATCGG - Intronic
901716196 1:11156540-11156562 TTGCAGTACTTCCTGGAGGAAGG - Intronic
902218711 1:14950916-14950938 CAGCAGTACCCACAGGAGAAAGG + Intronic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
903855707 1:26336676-26336698 GAACAGTACGTGCTGGAGAAGGG - Exonic
903855878 1:26337323-26337345 CACCAGTATCTGCTGGAGGAGGG - Exonic
904080929 1:27872388-27872410 CTGCAGTACCCTATGGGGAAGGG - Intergenic
904313877 1:29647287-29647309 CTGGAGCACCTTCTGCAGAAGGG - Intergenic
904340235 1:29829566-29829588 CTGGTGTCCCTGCTGGAGAGAGG - Intergenic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
906545478 1:46616756-46616778 CTGCGGGACCTGCAGGAGAAAGG - Intronic
909303236 1:74039352-74039374 CTGGAGTACCTGAAGGAGATGGG + Intronic
909924662 1:81425623-81425645 CTGTAGTGCCTGGTGGAGAATGG - Intronic
910730056 1:90385319-90385341 CTGCAGCCACTGGTGGAGAATGG - Intergenic
913090160 1:115471407-115471429 CCCCAGTCCCTGCTGGAAAATGG + Intergenic
915618407 1:157060704-157060726 ATGCAGTACTTGAAGGAGAACGG - Intergenic
915755889 1:158259252-158259274 GTGCAGTACATGCAGGAAAAGGG - Intergenic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918955384 1:191200238-191200260 CTGGAGTACCTGAAGGAGATGGG + Intergenic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919766027 1:201127805-201127827 CTGCAGTCCCTGGTGGAGGCTGG - Intergenic
919772743 1:201173099-201173121 GTGCAGCTCTTGCTGGAGAAGGG + Intergenic
921417623 1:214908959-214908981 ATACAGAACTTGCTGGAGAAAGG + Intergenic
923119677 1:230978651-230978673 CTGCAGCTCCTGCTTGAGCAGGG + Exonic
924628066 1:245711939-245711961 CCCCAGAACCTGCTGGAGAGGGG - Intergenic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
1064441158 10:15354720-15354742 GAGCAGTACCTGTTGTAGAATGG - Intronic
1067314888 10:45151863-45151885 GTGCGGTAGCTGCTGGAAAATGG - Intergenic
1070756015 10:78993747-78993769 CTGCTGTGCCTGCTGGAGGCAGG - Intergenic
1071356171 10:84798504-84798526 ATGCAGTCCCTGGTGGAGAAGGG + Intergenic
1071598865 10:86946551-86946573 CCACAGTACATGCTGGTGAAGGG - Intronic
1074158579 10:110818744-110818766 CTGCAGGAACTGCTTGGGAAGGG + Intronic
1074790255 10:116879423-116879445 ATGCAGTCTCTGGTGGAGAAAGG + Intronic
1074914938 10:117946472-117946494 CTGCAGTTCCTGCTGGTGCAGGG + Intergenic
1075661976 10:124203930-124203952 CTGCAGAACCTTCAGGAGGATGG + Intergenic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1076474560 10:130743186-130743208 CTGCAGTGCCTGATGGGGGAAGG - Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077921208 11:6643046-6643068 CTGAACTACCAGCTGGATAAAGG + Intronic
1078342161 11:10505420-10505442 CTGCAGCAGCTGCTGGGGATGGG - Intronic
1078696173 11:13634309-13634331 CTGCAGAATATGCCGGAGAAAGG - Intergenic
1078985828 11:16595732-16595754 CTGTTGTCCATGCTGGAGAACGG - Intronic
1079493717 11:21017207-21017229 CTGCAACAGCTTCTGGAGAATGG - Intronic
1079531457 11:21459501-21459523 CTGCAGTACTTGCTGGGTCAGGG + Intronic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1080696060 11:34603872-34603894 GTGCAGTGGCTGCTGGAGAGTGG + Intergenic
1081586481 11:44388144-44388166 CTTCAGTAGCTTCTTGAGAAAGG + Intergenic
1083160911 11:60853571-60853593 CTGCTGGGCCTGGTGGAGAATGG - Exonic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1086094306 11:83035294-83035316 ATGCATTACCTGCTGGGGAGGGG - Intronic
1087269683 11:96098687-96098709 CTGCGGTCTCTGCTGGGGAAAGG + Intronic
1087324043 11:96699336-96699358 CTGCAGTACCTTTTGGAAAATGG + Intergenic
1088596546 11:111445264-111445286 CTGCATTAACTGCTGGATTAGGG - Intronic
1088890007 11:114036706-114036728 CTGCTGTTTTTGCTGGAGAAGGG + Intergenic
1089101017 11:115962572-115962594 CTTCATAACCTGCTGGAGTAGGG - Intergenic
1089840819 11:121415968-121415990 CTTCAGTTCCAGCTGGAAAAGGG + Intergenic
1091238331 11:134036474-134036496 CTTGAGTACCAGCTGTAGAAGGG + Intergenic
1093627552 12:21367262-21367284 CTGCAGTAGCTTCCTGAGAATGG - Intronic
1093745197 12:22732268-22732290 CTGCTGTACCTGCTATAGAATGG - Intergenic
1097891481 12:64781265-64781287 ATGCTGTACCTGCGGCAGAAAGG + Intronic
1098147874 12:67516257-67516279 CTGCAGCACCTGCTAGGGACTGG + Intergenic
1099193389 12:79584157-79584179 CTGAAGTATCTGCAGGTGAAAGG + Intronic
1100367832 12:93937665-93937687 CTGCAGCCCCTGGTTGAGAAAGG - Intergenic
1100537088 12:95521604-95521626 CTGCAGTCCCAGCAGGAAAATGG - Intronic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1104668301 12:130663090-130663112 CTGCAGAACCTGCTGGTTGAAGG - Intronic
1105304265 13:19158065-19158087 CTGCAGTGGCTCCTGCAGAATGG + Intergenic
1106701878 13:32237866-32237888 CTGCAGCAGCTGCTGCTGAAAGG + Exonic
1107854012 13:44597195-44597217 CTCCAGTTCCTGCTAGTGAAAGG - Intergenic
1107914923 13:45139845-45139867 CCTCAGTACCTGCAGGAGATTGG + Intronic
1108062684 13:46549317-46549339 CCGCAGGAACTGCTGTAGAAAGG + Intergenic
1108142252 13:47436001-47436023 AGGCAGTACCTACTGGAGCAGGG + Intergenic
1110486574 13:76051565-76051587 CTATGGTACCTGCTGGTGAATGG + Intergenic
1110816804 13:79870277-79870299 CTGCTGGAACTGTTGGAGAAAGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1111929893 13:94502395-94502417 TGGCAATACCTGCTGGAGGAAGG - Intergenic
1112042170 13:95557603-95557625 CTGCTGTTCATGCTGGAGAAAGG + Intronic
1112629526 13:101145726-101145748 CTGCAGAAGGTCCTGGAGAAGGG - Intronic
1115715118 14:36094924-36094946 CTGCAGTTGCTGCTGGGGCAAGG + Intergenic
1117537372 14:56714911-56714933 CTGCAGTACCTGCTCCATACTGG + Intronic
1118635913 14:67748538-67748560 CTGCTGCACCTGCTGGACAAGGG + Exonic
1119796641 14:77404123-77404145 CTGTAGTACCTTCCTGAGAAAGG - Intronic
1120441871 14:84551627-84551649 CTGCAGTACAAGCTGGAGATAGG - Intergenic
1121270898 14:92637543-92637565 CAGCAGGACCCTCTGGAGAAGGG + Intronic
1122160241 14:99778635-99778657 CTGCAGTAGCTTCCTGAGAAAGG + Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124626763 15:31312201-31312223 CTGCAGCATCTGCAAGAGAAAGG + Intergenic
1125734837 15:41917617-41917639 CAGTTGTACCTGCTGGAGAAAGG + Intronic
1129388424 15:75208298-75208320 CTGAAGTAGATGCTGGAGCAGGG - Exonic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130772222 15:86936008-86936030 CTGCCTTGCCTGCTGGAGCAGGG - Intronic
1131830008 15:96348078-96348100 CTGAAGTCCCCGCTGGAGAAGGG - Intergenic
1132047042 15:98572788-98572810 CCGCAGGAACTCCTGGAGAATGG - Intergenic
1133111478 16:3550489-3550511 CTGGAGAACCTGCAAGAGAAGGG + Exonic
1133332421 16:4982716-4982738 CTGCTGTGGGTGCTGGAGAAGGG - Intronic
1134584018 16:15395804-15395826 GTGCAGTAGCTGCTGGAGGCTGG + Exonic
1134877910 16:17718566-17718588 CCCCAGAACCTGCTGGGGAAGGG - Intergenic
1135355907 16:21768825-21768847 CTGCAGAACTTTCTAGAGAAGGG + Intergenic
1135454397 16:22584964-22584986 CTGCAGAACTTTCTAGAGAAGGG + Intergenic
1136046757 16:27621408-27621430 GTGAAGTACCTGCCTGAGAATGG - Intronic
1136402840 16:30027969-30027991 GTACCGTCCCTGCTGGAGAATGG - Intronic
1136683338 16:31980485-31980507 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136783968 16:32924041-32924063 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136885814 16:33929765-33929787 CTGCAGCTGCTGCTGGAGAATGG - Intergenic
1138339344 16:56278549-56278571 CTGCAGTACCTGCTGGTGTGGGG + Intronic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1140274676 16:73497787-73497809 CTTCAATAGTTGCTGGAGAAAGG + Intergenic
1141543153 16:84742506-84742528 CTGCAGTACATGCAGTAGAGAGG - Intronic
1203086624 16_KI270728v1_random:1188043-1188065 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1143898609 17:10156549-10156571 GTGCAGGAGCTGCAGGAGAAGGG - Intronic
1144661457 17:17073443-17073465 CCACAGTTCCTCCTGGAGAAAGG + Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1146260017 17:31415006-31415028 CTGCTTCCCCTGCTGGAGAAGGG - Intronic
1146901473 17:36592098-36592120 CTTCAGTCCCTGCTGGACCAGGG - Exonic
1146937608 17:36822080-36822102 CTTCTGTTTCTGCTGGAGAAGGG - Intergenic
1147144250 17:38476196-38476218 CTGCAGCTGCTGCTGGAGAATGG + Intronic
1148151070 17:45396679-45396701 CTGCAGTCGCTGCGGGAGAAGGG - Exonic
1149685727 17:58533501-58533523 CAGCAGGAGGTGCTGGAGAAAGG + Intronic
1150330406 17:64289735-64289757 CTGCAGCACAGGCTGGATAATGG - Intergenic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1151689132 17:75669771-75669793 GTTCAGTAGGTGCTGGAGAAAGG + Intronic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151887793 17:76933344-76933366 CTGGAGTGGCTGCTGGAGAGGGG - Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152218750 17:79049390-79049412 TTGCAGGACCAGCTGGAGCAGGG + Exonic
1152747910 17:82049668-82049690 CGCCTGTACCTGCTGGAGCAGGG + Exonic
1152757038 17:82091392-82091414 GTGCAGAAGCTGCTGGAGCAGGG - Exonic
1152941906 17:83177223-83177245 CTGCAGAGCCTGCTGGAGCCGGG + Intergenic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1158721229 18:59926719-59926741 ATGCCATATCTGCTGGAGAATGG + Intergenic
1160859916 19:1233398-1233420 CTGTAGCACCTGGTGGAGAGTGG - Intronic
1162438972 19:10681008-10681030 CCGCAGTGCGTGCTGGAGAAGGG - Exonic
1162534252 19:11253652-11253674 CTGCAGCGCCTGCTGGAGTGGGG + Exonic
1165929917 19:39350787-39350809 CTGCACTCCCACCTGGAGAAAGG - Intronic
1166642050 19:44501418-44501440 CTGCTGGATCTGTTGGAGAATGG - Intergenic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
927895915 2:26781801-26781823 CTGCAGTATCTGTGGCAGAATGG - Intronic
929205781 2:39290954-39290976 CTGTAGTCCCAGCAGGAGAATGG + Intronic
930754586 2:54961634-54961656 CTGAGGTAGCTGATGGAGAAAGG + Intronic
932343298 2:70979823-70979845 ATCTACTACCTGCTGGAGAAAGG + Exonic
933250249 2:80021407-80021429 CTGCATTACCTGCTGATGATTGG + Intronic
934523448 2:95034119-95034141 ATGCAGCACCTGCCTGAGAATGG - Intronic
934628862 2:95892927-95892949 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629269 2:95898536-95898558 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934629684 2:95904152-95904174 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934630095 2:95909764-95909786 CTGCAGGAACTGCTGGAAGAAGG - Intronic
934803825 2:97197375-97197397 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934804243 2:97202980-97203002 CTGCAGGAACTGCTGGAAGAAGG + Intronic
934832816 2:97548798-97548820 CTGCAGGAACTGCTGGAAGAAGG - Intronic
935127565 2:100238008-100238030 CAGCACTATCTGCTGGGGAAGGG + Intergenic
937095986 2:119235487-119235509 CTGCAGTAGCTGCTCAGGAAAGG - Intronic
937222374 2:120349203-120349225 CTGCCCTACGTCCTGGAGAAGGG + Exonic
938444130 2:131364034-131364056 CTCCAAGACCTGCGGGAGAAAGG + Intergenic
940912830 2:159224232-159224254 GTGCTGTACCTGGTGGAGAAGGG + Exonic
942334069 2:174862167-174862189 CTGCAGGATCAGCTGTAGAAAGG + Intronic
944803876 2:203261931-203261953 CTGCAGCACCTCCTGCAGCATGG - Intronic
946327442 2:218992187-218992209 CAGCAGTTCATTCTGGAGAAGGG - Exonic
948425572 2:237884971-237884993 CTGCAGTGCCTGCTGTGGTACGG + Intronic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
1170052927 20:12166503-12166525 CTGCAGAAACTGCTGGCCAATGG - Intergenic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1170758287 20:19224490-19224512 CTGAACTACGTGCTGGATAAAGG + Intronic
1171032083 20:21685944-21685966 CTCCAGTGACTGCTGCAGAAAGG + Intergenic
1171969467 20:31554754-31554776 CCCCAGGATCTGCTGGAGAAAGG + Exonic
1172182327 20:33011042-33011064 CTGCAGGGCCCGCTGGAGAGGGG - Exonic
1172483650 20:35286231-35286253 ATGCACAAGCTGCTGGAGAAGGG - Exonic
1173563835 20:44025392-44025414 CTGCAGTACCTGTTGGCAAGTGG + Intronic
1173859137 20:46270605-46270627 CTGCAGTGCCTCCTGGAGAAAGG - Intronic
1173905181 20:46622489-46622511 CTCAAGTGCCTGCTGGACAAAGG - Intronic
1174090885 20:48046435-48046457 CTTCAGTACCCTCTGCAGAATGG - Intergenic
1174860423 20:54086270-54086292 CTGGAGGACATGCAGGAGAAGGG - Intergenic
1175028071 20:55924085-55924107 CTGTGGTAGCTGCTGGAGACCGG - Intergenic
1178536386 21:33413634-33413656 GTGAAGTACCTGCTTGGGAAAGG + Intronic
1179592108 21:42415666-42415688 CAGCAGCATCTGCTGGAGGACGG - Intronic
1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG + Exonic
1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG + Intergenic
1182529605 22:30945047-30945069 CTGCAGGGCCACCTGGAGAAAGG - Intronic
1182600700 22:31461345-31461367 GTGAAGTACCTGCTGCAGAGTGG - Intronic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1184424558 22:44401958-44401980 CCACAGTCCCTGCTTGAGAAGGG + Intergenic
1185000597 22:48243109-48243131 CTTCATTGCTTGCTGGAGAAAGG + Intergenic
950234687 3:11308482-11308504 CTGCAGACTCTGCTGGGGAACGG - Intronic
951471712 3:23063590-23063612 CTTCAGACCCTGTTGGAGAAGGG - Intergenic
951763718 3:26173324-26173346 CTGCACTGCTTTCTGGAGAATGG - Intergenic
952956185 3:38559049-38559071 CTGCACTGCCTAGTGGAGAATGG - Intronic
954199966 3:49018310-49018332 CTCCGGAACCTGCGGGAGAACGG + Exonic
958524807 3:95241966-95241988 CTGCAGTAGCTGCAGGATCATGG + Intergenic
960103510 3:113769709-113769731 CTGCAGTGCCTGTTGGGGAGAGG + Intronic
961753991 3:129115949-129115971 ATACAGTACATGCTGGACAAAGG - Intronic
962033052 3:131621590-131621612 CTGCAGTATCTGAGGGATAATGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
963094400 3:141520375-141520397 GTGGTGTACCTGCTGGAGGAGGG + Intronic
964636101 3:158859812-158859834 CCGCAGTCCATGCTGGAGACTGG + Intergenic
964748401 3:160032858-160032880 CTGGAGAACCTGCTGGAAAACGG - Intergenic
965162311 3:165150109-165150131 CTGTAGTCCCAGCAGGAGAATGG - Intergenic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
970740959 4:19237107-19237129 CTTCAGTTGTTGCTGGAGAAGGG - Intergenic
972330237 4:38057409-38057431 CTGCAGGAGCTGCCGGAGATGGG - Intronic
972536050 4:40000852-40000874 CTTCAGTATCTGCTGGGGATTGG + Intergenic
974349262 4:60723618-60723640 CTGTGGTACCTGGTGGAGAGAGG - Intergenic
974724981 4:65787117-65787139 CTGCAGACCCTGCTGGTTAAAGG + Intergenic
980230638 4:130041953-130041975 CTACAGTAACTGCTTAAGAATGG + Intergenic
980309165 4:131102846-131102868 CTGCAGTGGCTGCTGCAGATGGG + Intergenic
980576476 4:134688513-134688535 CTTCAGTATCTCCTGGGGAAGGG - Intergenic
980924918 4:139126794-139126816 CTCCAGTATCTTCTTGAGAAAGG - Intronic
981985988 4:150856438-150856460 CTGCAGTGCCTTCTTAAGAAAGG + Intronic
983702087 4:170610015-170610037 ATGTAGTACCAGCTTGAGAAAGG + Intergenic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984922500 4:184778140-184778162 CTGCCCTACCTACTGGACAAAGG + Intronic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985528478 5:420129-420151 GTGCAGTTCCTGGAGGAGAAGGG + Intronic
987090831 5:14506783-14506805 CTGCGGTATCTGCTGAAGGAAGG - Intronic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
989176736 5:38535036-38535058 CTGCAGTAGCTTCCAGAGAATGG - Intronic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
989730588 5:44642433-44642455 CTGCAGTGGCTGCTCCAGAAAGG + Intergenic
991183443 5:63781106-63781128 CTAGCTTACCTGCTGGAGAATGG - Intergenic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996136216 5:119845724-119845746 CTTCAGTATATGGTGGAGAAGGG - Intergenic
996876746 5:128249068-128249090 CTGGAGCACATGCTGGAGAAAGG - Intergenic
998307804 5:141096477-141096499 GTGCTGTACCCGCTGCAGAACGG + Exonic
998308442 5:141102330-141102352 GTGCTGTACCCGCTGCAGAACGG + Exonic
998310350 5:141123676-141123698 GTGCTGTACCCGCTGCAGAATGG + Exonic
998313480 5:141157681-141157703 GTGCTGTACCCGCTGCAGAACGG + Intergenic
998315551 5:141179718-141179740 GTGCTGTACCCGCTGCAGAATGG + Exonic
998316093 5:141184240-141184262 GTGCTGTACCCGCTGCAGAACGG + Exonic
998316648 5:141188999-141189021 GTGCTGTACCCGCTGCAGAACGG + Exonic
998317282 5:141194233-141194255 GTGCTGTACCCGCTGCAGAACGG + Exonic
998317954 5:141201455-141201477 GTGCTGTACCCGCTGCAGAACGG + Exonic
998318914 5:141210588-141210610 GTGCTGTACCCGCTGCAGAACGG + Exonic
998319481 5:141215804-141215826 GTGCTGTACCCGCTGCAGAACGG + Exonic
998320455 5:141225186-141225208 GTGCTGTACCCGCTGCAGAACGG + Exonic
998321468 5:141236235-141236257 GTGCTGTACCCGCTGCAGAACGG + Intergenic
998322695 5:141247259-141247281 GTGCTGTACCCGCTGCAGAACGG + Exonic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
998708932 5:144798773-144798795 CTGCAGTAGCTGTCAGAGAATGG + Intergenic
999851287 5:155542031-155542053 CTCCAGTTCCTGCCGGTGAAGGG + Intergenic
1000319208 5:160120070-160120092 CTGCACTAGGTGCTGGGGAATGG + Intergenic
1001930361 5:175668620-175668642 CTCCAGGACCTGATGAAGAAAGG - Intronic
1003248909 6:4407168-4407190 CTGGAGTACCTGAAGGAGATGGG + Intergenic
1005128380 6:22474340-22474362 TTGTAATACCTGCTGGAGTATGG + Intergenic
1005128388 6:22474397-22474419 TTGTAATACCTGCTGGAGTATGG + Intergenic
1005280360 6:24267566-24267588 CTCCAGTAATTTCTGGAGAATGG - Intronic
1005695001 6:28343646-28343668 CTGTAGTCCCAGCAGGAGAATGG - Intronic
1007402066 6:41608545-41608567 CTGCTGAGTCTGCTGGAGAAGGG - Intergenic
1007655726 6:43450027-43450049 CTGCAGCAGCTGCTGGAACAGGG - Exonic
1008381849 6:50845900-50845922 CCCCATTACCTACTGGAGAATGG - Exonic
1008749462 6:54714872-54714894 CTGAACTACCTAATGGAGAAGGG - Intergenic
1013387124 6:109642663-109642685 CTGCTGTATATGCTGGTGAATGG + Intronic
1013408800 6:109866108-109866130 CTTCAGTAGCTGCGGGAGGAAGG + Intergenic
1016580790 6:145627636-145627658 CTGCATGCGCTGCTGGAGAAGGG - Exonic
1017827894 6:158095901-158095923 CTGCAGGACCTGCAGGTGGAAGG - Exonic
1021256782 7:18402056-18402078 CTTCAGTACCTTTTTGAGAAAGG + Intronic
1026846920 7:73703780-73703802 CTGGAGGACATGCTGGAGAGTGG - Exonic
1027512599 7:79101685-79101707 CTGTAGCACCTGCTGGAGTGCGG - Intronic
1027791126 7:82639761-82639783 CTCCAGTAGCTGCTTGAGGAAGG - Intergenic
1029172967 7:98643778-98643800 CTGCTGTGCCAGGTGGAGAAGGG + Intergenic
1029216558 7:98954589-98954611 CTGCAGAACCTGCTGGTGCCTGG - Intronic
1030319672 7:108152189-108152211 CTGCAGAAGGTGTTGGAGAAGGG + Intronic
1033735989 7:144222403-144222425 CTGCTGTATCTGATGGGGAAGGG + Intergenic
1033747062 7:144328549-144328571 CTGCTGTATCTGATGGGGAAGGG - Intergenic
1034073043 7:148206532-148206554 CTGCAGGTGCTGCTGAAGAAAGG - Intronic
1034293465 7:149950303-149950325 AGGGAGCACCTGCTGGAGAAGGG + Intergenic
1034812600 7:154146550-154146572 AGGGAGCACCTGCTGGAGAAGGG - Intronic
1035465376 7:159071762-159071784 CTGCAGCACCTGCTGGATGAAGG + Intronic
1035465391 7:159071868-159071890 CTGCAGCACCTGCTGGATGAAGG + Intronic
1035465405 7:159071974-159071996 CTGCAGCACCTGCTGGATGAAGG + Intronic
1035465421 7:159072081-159072103 CTGCAGCACCTGCTGGATGAAGG + Intronic
1035465438 7:159072188-159072210 CTGCGGCACCTGCTGGATGAAGG + Intronic
1037359297 8:18055753-18055775 CTGTAGTTCCTACTGGATAATGG - Intergenic
1039665918 8:39527959-39527981 CTGAAGTTCCTGTTGGAGGAAGG - Intergenic
1039693169 8:39882813-39882835 CTCCAGTAGCTGCTCGAGGAAGG + Intergenic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1040981897 8:53252556-53252578 CTCCAGTACCCTGTGGAGAAGGG - Intergenic
1041003200 8:53471948-53471970 CTGTAGTACCTGGTTGACAAGGG + Intergenic
1042351107 8:67778641-67778663 CTGCAGTAGCTGCATCAGAATGG + Intergenic
1043280634 8:78461295-78461317 CTGCAGGAACTTGTGGAGAATGG + Intergenic
1044955477 8:97475603-97475625 TTGGAGTGCCTGCTGGAGAGTGG + Intergenic
1046937169 8:119895625-119895647 CTGCAGTTTCTGCTGTGGAAAGG + Intronic
1047366438 8:124215906-124215928 GTGCAGTGCTTGCTGGAGAATGG + Intergenic
1048919311 8:139213448-139213470 CTGCAGGTGCTGCTGCAGAAGGG - Intergenic
1049204901 8:141359156-141359178 CTCCCCCACCTGCTGGAGAAGGG + Intronic
1049258619 8:141626940-141626962 CTGCGACACCTTCTGGAGAAGGG + Intergenic
1049618331 8:143586283-143586305 CTGCACTGTCTGCAGGAGAACGG - Exonic
1053557422 9:39152454-39152476 CAGCAGAACCTTCTGAAGAATGG + Intronic
1053821533 9:41972730-41972752 CAGCAGAACCTTCTGAAGAATGG + Intronic
1054139693 9:61466497-61466519 CAGCAGAACCTTCTGAAGAATGG - Intergenic
1054609035 9:67214686-67214708 CAGCAGAACCTTCTGAAGAATGG - Intergenic
1055156191 9:73065792-73065814 CTTCAGTTCCTGCTGGTGAAGGG + Intronic
1056154183 9:83817976-83817998 CAGAACCACCTGCTGGAGAAGGG + Intronic
1056356325 9:85805133-85805155 CAGAACCACCTGCTGGAGAAAGG - Intergenic
1057076669 9:92141665-92141687 CCGCAGTACCAGGTGGAGACAGG - Intergenic
1059153155 9:111967124-111967146 CTGCAGGATCTGCTGGGGGAGGG - Intergenic
1060898102 9:127232260-127232282 CTTCAGTAGCTGAAGGAGAAGGG - Intronic
1061560984 9:131403007-131403029 CTGCAGGACCTACTGGAAAAAGG + Intronic
1062250210 9:135590043-135590065 CTGCCTCACCTGCTGGAGCAGGG - Intergenic
1062307825 9:135919675-135919697 TTGCAGAACCTGGGGGAGAAGGG - Intergenic
1062359519 9:136180941-136180963 CTGCAGAACGTTCTGGCGAATGG - Intergenic
1186349280 X:8727170-8727192 CTGCAGTACTCACTGGAGAGTGG + Intronic
1186452347 X:9684136-9684158 CTGCAGGCCCTTCTGGAGAATGG - Exonic
1187917251 X:24165600-24165622 ATGCAGTACATGATGAAGAAAGG - Intronic
1188620140 X:32210784-32210806 CGGCAGTACCTGTTAGATAAGGG + Intronic
1188823838 X:34805772-34805794 CAGCAGCACATGGTGGAGAAGGG - Intergenic
1188977295 X:36690820-36690842 GTGCAGTGCCAGCTGTAGAAGGG - Intergenic
1189277521 X:39797546-39797568 CTGCAGGTCTGGCTGGAGAAAGG + Intergenic
1189675050 X:43453016-43453038 CTCCAGTTCCTGCTTGTGAAGGG - Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1190727112 X:53196944-53196966 CTGCAGTCCCTGTTGGAGAGGGG - Exonic
1191714914 X:64187570-64187592 CTCCAGACCCTGCTGGAGAAGGG - Exonic
1192398411 X:70808934-70808956 CTCCAGTAGCTTCTTGAGAAAGG - Intronic
1193234789 X:79093608-79093630 CAGCAGGACCTGATGGAGATAGG + Intergenic
1193572285 X:83159533-83159555 CATCAGTAGCTGCTTGAGAAAGG - Intergenic
1197708169 X:129648612-129648634 CTCAAGTACCTGCTTCAGAAAGG + Exonic
1197839482 X:130730245-130730267 CTGCAGTAGCTGGTGGGGACAGG + Intronic
1198963874 X:142207833-142207855 CTGCTGTAACACCTGGAGAAAGG - Intergenic
1200761482 Y:7043073-7043095 CTGCAGTCCCTTCTGGAGAATGG - Exonic
1200779692 Y:7203265-7203287 CTGCATAGCCTGTTGGAGAAAGG + Intergenic