ID: 1181788170

View in Genome Browser
Species Human (GRCh38)
Location 22:25242684-25242706
Sequence TTGGACAGAAACTGCTATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181788170_1181788173 -3 Left 1181788170 22:25242684-25242706 CCGAGATAGCAGTTTCTGTCCAA No data
Right 1181788173 22:25242704-25242726 CAAAAGATTGGTCCACATATTGG No data
1181788170_1181788176 20 Left 1181788170 22:25242684-25242706 CCGAGATAGCAGTTTCTGTCCAA No data
Right 1181788176 22:25242727-25242749 CCAAATCCTCCTTTTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181788170 Original CRISPR TTGGACAGAAACTGCTATCT CGG (reversed) Intergenic
No off target data available for this crispr