ID: 1181790618

View in Genome Browser
Species Human (GRCh38)
Location 22:25262937-25262959
Sequence GTGTGTTGCAGAGGTCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181790618_1181790626 25 Left 1181790618 22:25262937-25262959 CCACGCAGACCTCTGCAACACAC No data
Right 1181790626 22:25262985-25263007 ACCCATCAACAACAAGAAGGAGG No data
1181790618_1181790628 26 Left 1181790618 22:25262937-25262959 CCACGCAGACCTCTGCAACACAC No data
Right 1181790628 22:25262986-25263008 CCCATCAACAACAAGAAGGAGGG No data
1181790618_1181790621 2 Left 1181790618 22:25262937-25262959 CCACGCAGACCTCTGCAACACAC No data
Right 1181790621 22:25262962-25262984 GAGCCTGAGCCCACTGCTGCAGG No data
1181790618_1181790625 22 Left 1181790618 22:25262937-25262959 CCACGCAGACCTCTGCAACACAC No data
Right 1181790625 22:25262982-25263004 AGGACCCATCAACAACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181790618 Original CRISPR GTGTGTTGCAGAGGTCTGCG TGG (reversed) Intergenic
No off target data available for this crispr