ID: 1181791378

View in Genome Browser
Species Human (GRCh38)
Location 22:25269572-25269594
Sequence TTTTTTACGGGGATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181791370_1181791378 -7 Left 1181791370 22:25269556-25269578 CCAGCCCTGGGCTGGGTTTTTTA No data
Right 1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG No data
1181791369_1181791378 -6 Left 1181791369 22:25269555-25269577 CCCAGCCCTGGGCTGGGTTTTTT No data
Right 1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG No data
1181791365_1181791378 2 Left 1181791365 22:25269547-25269569 CCACCGTGCCCAGCCCTGGGCTG No data
Right 1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG No data
1181791368_1181791378 -1 Left 1181791368 22:25269550-25269572 CCGTGCCCAGCCCTGGGCTGGGT No data
Right 1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG No data
1181791362_1181791378 29 Left 1181791362 22:25269520-25269542 CCGAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG No data
1181791361_1181791378 30 Left 1181791361 22:25269519-25269541 CCCGAAGTGCTGGGATTACAGGC 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877
Right 1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181791378 Original CRISPR TTTTTTACGGGGATCATGGA GGG Intergenic
No off target data available for this crispr