ID: 1181792945

View in Genome Browser
Species Human (GRCh38)
Location 22:25282404-25282426
Sequence CCCGATGCCCCTTGAGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181792940_1181792945 -5 Left 1181792940 22:25282386-25282408 CCAGGTAGCAGAGGCCTCCCCGA No data
Right 1181792945 22:25282404-25282426 CCCGATGCCCCTTGAGTAGTGGG No data
1181792936_1181792945 16 Left 1181792936 22:25282365-25282387 CCCGTTTGAGAACTACTGTGTCC No data
Right 1181792945 22:25282404-25282426 CCCGATGCCCCTTGAGTAGTGGG No data
1181792937_1181792945 15 Left 1181792937 22:25282366-25282388 CCGTTTGAGAACTACTGTGTCCA No data
Right 1181792945 22:25282404-25282426 CCCGATGCCCCTTGAGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181792945 Original CRISPR CCCGATGCCCCTTGAGTAGT GGG Intergenic
No off target data available for this crispr