ID: 1181793048

View in Genome Browser
Species Human (GRCh38)
Location 22:25282798-25282820
Sequence GCTGGTGGGGCGCGCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181793040_1181793048 10 Left 1181793040 22:25282765-25282787 CCGGCGGGCTACAGCCTGCGGCG No data
Right 1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG No data
1181793039_1181793048 11 Left 1181793039 22:25282764-25282786 CCCGGCGGGCTACAGCCTGCGGC No data
Right 1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG No data
1181793043_1181793048 -4 Left 1181793043 22:25282779-25282801 CCTGCGGCGCTTGCAGGGCGCTG No data
Right 1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG No data
1181793037_1181793048 12 Left 1181793037 22:25282763-25282785 CCCCGGCGGGCTACAGCCTGCGG No data
Right 1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181793048 Original CRISPR GCTGGTGGGGCGCGCCGAGC AGG Intergenic
No off target data available for this crispr