ID: 1181795000

View in Genome Browser
Species Human (GRCh38)
Location 22:25301473-25301495
Sequence CTGTCTGTGAAGAGGGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181794996_1181795000 5 Left 1181794996 22:25301445-25301467 CCACTTTATCTGATTTACAAAAA No data
Right 1181795000 22:25301473-25301495 CTGTCTGTGAAGAGGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181795000 Original CRISPR CTGTCTGTGAAGAGGGTCTT TGG Intergenic
No off target data available for this crispr