ID: 1181796951

View in Genome Browser
Species Human (GRCh38)
Location 22:25318262-25318284
Sequence TCCTGCTCCAGCGCGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 1, 2: 1, 3: 12, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181796947_1181796951 -6 Left 1181796947 22:25318245-25318267 CCTCACACCCAGCAGGTTCCTGC No data
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175
1181796940_1181796951 29 Left 1181796940 22:25318210-25318232 CCTAGATCACAGCCTACACACTG No data
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175
1181796945_1181796951 -4 Left 1181796945 22:25318243-25318265 CCCCTCACACCCAGCAGGTTCCT No data
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175
1181796942_1181796951 3 Left 1181796942 22:25318236-25318258 CCCTGTGCCCCTCACACCCAGCA 0: 2
1: 1
2: 4
3: 61
4: 460
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175
1181796943_1181796951 2 Left 1181796943 22:25318237-25318259 CCTGTGCCCCTCACACCCAGCAG No data
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175
1181796946_1181796951 -5 Left 1181796946 22:25318244-25318266 CCCTCACACCCAGCAGGTTCCTG No data
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175
1181796941_1181796951 17 Left 1181796941 22:25318222-25318244 CCTACACACTGCAGCCCTGTGCC No data
Right 1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG 0: 2
1: 1
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181796951 Original CRISPR TCCTGCTCCAGCGCGGCTCC TGG Intergenic