ID: 1181798113

View in Genome Browser
Species Human (GRCh38)
Location 22:25325093-25325115
Sequence GTTGTGTAAGACTACACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181798113_1181798117 30 Left 1181798113 22:25325093-25325115 CCAGCAGTGTAGTCTTACACAAC No data
Right 1181798117 22:25325146-25325168 GCCTGAACTCACTGAGTGTTGGG No data
1181798113_1181798114 -4 Left 1181798113 22:25325093-25325115 CCAGCAGTGTAGTCTTACACAAC No data
Right 1181798114 22:25325112-25325134 CAACTGAACTCTCTAAGCCTTGG No data
1181798113_1181798116 29 Left 1181798113 22:25325093-25325115 CCAGCAGTGTAGTCTTACACAAC No data
Right 1181798116 22:25325145-25325167 TGCCTGAACTCACTGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181798113 Original CRISPR GTTGTGTAAGACTACACTGC TGG (reversed) Intergenic
No off target data available for this crispr