ID: 1181799541

View in Genome Browser
Species Human (GRCh38)
Location 22:25335489-25335511
Sequence CCTCACCTGCAGTAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 2, 1: 0, 2: 4, 3: 24, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181799534_1181799541 14 Left 1181799534 22:25335452-25335474 CCGAGGAAAGGGCAGAGTGATGT No data
Right 1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG 0: 2
1: 0
2: 4
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181799541 Original CRISPR CCTCACCTGCAGTAGGAGGC TGG Intergenic
900512355 1:3066702-3066724 CCTGAGCTGGAGGAGGAGGCAGG + Intergenic
902862198 1:19254420-19254442 CCTCACCTGCTGGCTGAGGCAGG - Intronic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
912227131 1:107746658-107746680 CCGCACCTGCCGAGGGAGGCTGG - Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
912963381 1:114215930-114215952 CCTCTCCTGCAGGAGGAGATAGG - Intergenic
915164554 1:153941368-153941390 TCTCACCTGCACTAGGATGCGGG + Exonic
915307793 1:154990590-154990612 GCTCACCTGCAGTAGTGGGGAGG + Intronic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
915634799 1:157178510-157178532 CTTCTGCTGCAGTAGGAGGGTGG + Intergenic
916010612 1:160702284-160702306 CCTCCTCCACAGTAGGAGGCGGG - Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
918251208 1:182704933-182704955 CACAACCTGCAGTAGGAGGCTGG - Intergenic
920135167 1:203763665-203763687 ACTCACCTGCAGTCTGAGGCAGG + Intergenic
922765872 1:228156591-228156613 CCTCAGCTGCATAAAGAGGCCGG + Intronic
923942622 1:238844581-238844603 CCTCTGCTGGAGTAGGAAGCTGG - Intergenic
1062856672 10:783342-783364 CCTCACCTGGAGGAACAGGCAGG - Intergenic
1062911888 10:1216861-1216883 CCTCACCAGAAGTGGGATGCAGG + Intronic
1062973617 10:1666575-1666597 CCTCGGCTGCAGGAGGACGCTGG - Intronic
1065629141 10:27659800-27659822 CACCACCAGAAGTAGGAGGCAGG - Intergenic
1069919488 10:71807829-71807851 CCACCCCTGCAGGAAGAGGCAGG - Exonic
1071394275 10:85206256-85206278 GCTCACCTGGACAAGGAGGCGGG + Intergenic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1073206908 10:101774451-101774473 CCCCAGCTGCAGGTGGAGGCAGG - Intronic
1074525685 10:114261169-114261191 TCTGACCTGCAGTAGGAGACAGG - Exonic
1075744682 10:124718568-124718590 CCTCCCCTGCAGTAGGAGTCAGG - Intronic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1077077916 11:709541-709563 CCTCCCCTGCAGTGGCAGCCTGG + Exonic
1077347964 11:2073079-2073101 CCTGGCCGGCAGGAGGAGGCAGG - Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1081748171 11:45487652-45487674 CAACACCTGCAGTACCAGGCAGG - Intergenic
1082759960 11:57117722-57117744 GCAGTCCTGCAGTAGGAGGCAGG + Intergenic
1084694180 11:70744108-70744130 CCTCCCCTTGGGTAGGAGGCAGG - Intronic
1085770350 11:79320007-79320029 CCTCCACTGCAGTAGAAGGTAGG - Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1089602411 11:119623978-119624000 CCTCCCCTGCACCAGGAGCCGGG + Intronic
1089654171 11:119935076-119935098 CCCCTCCTGCAGGAGAAGGCAGG - Intergenic
1090993895 11:131847491-131847513 GCCAACCTGCAGGAGGAGGCAGG + Intronic
1091071672 11:132570433-132570455 CCTCATCTTCAGGAGCAGGCAGG + Intronic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1094236754 12:28177011-28177033 CATTTCCTGCAGGAGGAGGCTGG + Intronic
1097236852 12:57546490-57546512 CCTCACCTTGAGAAGCAGGCAGG + Intronic
1098301120 12:69055145-69055167 GCTCTCCTGCAGGAGCAGGCGGG + Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1102352999 12:112208529-112208551 CATCATCTGCAATGGGAGGCGGG + Exonic
1103920427 12:124396596-124396618 CCTGACCTGCAGCGGCAGGCAGG + Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108277899 13:48829638-48829660 CCTTTGCTGCAATAGGAGGCAGG + Intergenic
1113848518 13:113405237-113405259 TGTCACCAGCAGTAGGGGGCAGG + Intergenic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1116317547 14:43417378-43417400 TTGCACCTGCAGTAGGTGGCCGG + Intergenic
1119650776 14:76381338-76381360 CCTCACCAGTGGCAGGAGGCAGG - Intronic
1123190085 14:106560972-106560994 ACACGCCTGCAGTAGGAGGAAGG - Intergenic
1124829949 15:33138589-33138611 CCTCACTTCCAGGAGGAGTCAGG - Intronic
1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG + Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128323392 15:66707560-66707582 CCTCACCTCCAGGAGGAGCTAGG - Intronic
1131026804 15:89149824-89149846 CCTCACTTGGCCTAGGAGGCCGG - Intronic
1131076207 15:89496482-89496504 AATCACCTGCAGGAGCAGGCAGG + Exonic
1131270187 15:90942519-90942541 CATAACCTGCAGCAGGTGGCAGG - Exonic
1133071482 16:3249484-3249506 CCTCATCTGCAGTCTGAGTCAGG - Exonic
1133739192 16:8639146-8639168 CCTCACCTCCAGTGGCAGCCAGG - Exonic
1133932298 16:10242374-10242396 CATGACCTGCAGCAGGCGGCTGG + Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1135698255 16:24609703-24609725 CCCCAGCTGCAGTAGGAGTCAGG - Intergenic
1138548552 16:57734818-57734840 CCTGACCTGCGGTGAGAGGCTGG + Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1139650164 16:68358226-68358248 CCTGTCCTGCAGTTGGGGGCAGG + Exonic
1140083363 16:71772240-71772262 CCTCACCTGGAGGCTGAGGCAGG - Intronic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1143750691 17:9024721-9024743 CCTCCCTTGCAACAGGAGGCGGG - Intronic
1143826233 17:9610069-9610091 CCTCACCTGTATTAGGATTCAGG - Intronic
1144136470 17:12300198-12300220 CCTCACTTGGAGTAGGAGATGGG - Intergenic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1145009550 17:19360052-19360074 CAACACCTGCAGTAGGAGGCAGG - Intronic
1145235533 17:21205447-21205469 TCTCCGCTGCAGGAGGAGGCAGG + Intronic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1146686196 17:34843097-34843119 CCTCACCTCCCGTAGCAGGACGG - Intergenic
1147629920 17:41923520-41923542 ACTCACCTGCAGCAGGTTGCAGG - Intronic
1147976565 17:44251327-44251349 CTTCACCTGCAGGCGGAGGCTGG + Exonic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1150143775 17:62751291-62751313 CCTCACCTGCAAAACGAGACGGG + Intronic
1152185886 17:78856078-78856100 GCACACCTGCAGTAGGAGGGGGG - Intronic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1152558582 17:81066832-81066854 CTCCACCTGCAGGAGGAGGCTGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152737471 17:82004486-82004508 CTTCACCTGCAGGAGGAGTCGGG + Intronic
1155577073 18:27259587-27259609 ACACACCTGCAGGAGGTGGCTGG + Intergenic
1157604183 18:48915300-48915322 CCGCAGCTGCAGTCAGAGGCTGG - Intergenic
1159037616 18:63292910-63292932 CATCACCTGCAGCAGCAGGAAGG - Intronic
1160893712 19:1393138-1393160 CCTGGCCTGCAGTTGAAGGCGGG + Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161895267 19:7075089-7075111 ACTCACCGGCAGTTGGGGGCAGG - Exonic
1162298661 19:9830897-9830919 CCTCACCTGAGGCAGGAGACTGG + Intergenic
1163170536 19:15527969-15527991 CCTCACCTGCTGTATGAGGCAGG - Intronic
1163798087 19:19348657-19348679 CCTGTCCTGCAGTAGGTGACAGG - Intronic
1164245269 19:23422653-23422675 CCTAACGTGGAGAAGGAGGCAGG + Intergenic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164628660 19:29746627-29746649 CCCCTCCAGCAGTAGGAGTCTGG - Intergenic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1166528364 19:43527091-43527113 CCGCACCTGCCGCAGGAGGATGG + Exonic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167380401 19:49134899-49134921 TGTCACCTGGAGTAGGAGGATGG - Exonic
1168097610 19:54124482-54124504 CCACACCTGCGGTGGGAGGGAGG - Exonic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
1202635640 1_KI270706v1_random:41567-41589 CCTCAGCTGCACAAGGAAGCAGG - Intergenic
925349994 2:3194302-3194324 CCTGCCCTGCAGGAAGAGGCTGG + Intronic
925789586 2:7470477-7470499 AGTCACCTGCAGGAGGTGGCTGG + Intergenic
925912942 2:8584863-8584885 CTTCACCTGCAGGAGGAGCTGGG - Intergenic
926312085 2:11682174-11682196 GCTCACCTGCAGGAGGAGTGGGG - Intronic
926561741 2:14425432-14425454 GCTCAGCAGCAGTAGGTGGCTGG - Intergenic
932432274 2:71683176-71683198 GCCCACCTGCTGCAGGAGGCAGG - Intronic
933471913 2:82736249-82736271 CCTCAGCTGAAGAAGAAGGCGGG - Intergenic
934614820 2:95764388-95764410 CCTGCCCTCCAGTAGGAGCCAGG - Intergenic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
936249933 2:110860468-110860490 CCGCAGCTGCAGTAAGAGGCTGG + Intronic
936675352 2:114708228-114708250 CCTCAGCTGCAGTATGAAGTGGG - Intronic
937232298 2:120405278-120405300 CCTCACACGCAGTAGGTGCCTGG + Intergenic
938163501 2:129007128-129007150 CCTCTCCTGAAGTGGGAGCCTGG - Intergenic
938332305 2:130456430-130456452 CCTCACCCACAGAAGGAAGCAGG - Intergenic
938357502 2:130664238-130664260 CCTCACCCACAGAAGGAAGCAGG + Intergenic
938433936 2:131271025-131271047 CCTCACCCACAGAAGGAAGCAGG + Intronic
938662913 2:133505652-133505674 TCACACAGGCAGTAGGAGGCAGG + Intronic
938776387 2:134544978-134545000 CCTCCCCTCCAGGAGGGGGCTGG - Intronic
942957293 2:181788103-181788125 CCTCACCTGCAATGGGAGATGGG + Intergenic
944700520 2:202241827-202241849 CCTCAGCCCTAGTAGGAGGCTGG - Intergenic
945297627 2:208186755-208186777 CCTCACCTGTGGTGCGAGGCAGG - Intronic
947463706 2:230323784-230323806 CCCCACCTTCAGAAGGTGGCCGG + Intergenic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
1169131450 20:3168138-3168160 CCGCGGCTGCAGTAGGTGGCAGG + Intronic
1170732794 20:18988939-18988961 CCTCACCTGGAGGCAGAGGCGGG + Intergenic
1172766926 20:37355975-37355997 CCACACCTGCAGCAAGAGTCTGG - Intronic
1175801616 20:61804289-61804311 CCTCACCTGCACCATGTGGCTGG - Intronic
1175855576 20:62119153-62119175 CCTTACCTGCTGCAGGATGCTGG + Intergenic
1176185914 20:63778973-63778995 CCTGACCTGCAGATGGCGGCAGG + Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1178351193 21:31873857-31873879 CCTCATCGGCAGCAGGAAGCTGG + Exonic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180064724 21:45406328-45406350 CCTCACCCGCTGTAGCAAGCAGG - Intronic
1180106595 21:45622858-45622880 CCTCATCTGCAGGAGGACACTGG - Intergenic
1180710051 22:17833305-17833327 CCTTGCCTGCAGTGAGAGGCCGG + Intronic
1180744676 22:18079240-18079262 CCTCACCTGCCAGACGAGGCTGG - Intronic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1180918695 22:19507074-19507096 CCACACATGACGTAGGAGGCTGG - Intronic
1180988034 22:19917159-19917181 AGCCACCTGCAGAAGGAGGCTGG - Intronic
1181467012 22:23115708-23115730 CCCCACCTGAAGTTGGGGGCCGG + Intronic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1184358610 22:43999522-43999544 TCCTACCTGCAGCAGGAGGCTGG + Exonic
949875458 3:8623543-8623565 GCTCACCTGCTGCAGGACGCGGG + Exonic
950534215 3:13570014-13570036 CCTCACCTGCATTCTGAGGCAGG - Intronic
950785310 3:15429059-15429081 CCTGTCCTGCAGTTTGAGGCAGG + Intronic
950968552 3:17163980-17164002 AATCAGCTGCAGTAGAAGGCAGG - Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954613739 3:51959201-51959223 CCACCCCTGCACAAGGAGGCAGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954701085 3:52451222-52451244 ACTCAGCTGGAGTTGGAGGCTGG + Exonic
955435926 3:58899107-58899129 CTGCACCTGTAGGAGGAGGCTGG + Intronic
956754830 3:72374121-72374143 CAGCACCTGCAGCAGCAGGCAGG + Exonic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
962044544 3:131741767-131741789 CAGCCTCTGCAGTAGGAGGCTGG - Intronic
962891077 3:139673596-139673618 ACTCTCCTGAAGGAGGAGGCTGG - Intronic
965276906 3:166695315-166695337 CCTCACCTGCAATTGAATGCTGG - Intergenic
965634726 3:170769533-170769555 CCTCACTCCCAGAAGGAGGCAGG + Intronic
966762339 3:183428881-183428903 CCACACCTGCACTGGGAGCCCGG + Intergenic
968813631 4:2810947-2810969 CCACACCTTCAGCAGAAGGCTGG - Intronic
969605427 4:8199971-8199993 GCACACCTGCAGTTGAAGGCTGG - Intronic
969718561 4:8880434-8880456 CCTTACCTACTGGAGGAGGCAGG + Intergenic
970445919 4:16123302-16123324 CCTCATATCCAGTAAGAGGCAGG + Intergenic
971822776 4:31580234-31580256 CCTCACATGAAGTAAGGGGCAGG - Intergenic
975909989 4:79256090-79256112 ACCCAACTGAAGTAGGAGGCAGG - Intronic
977937879 4:102827256-102827278 CCTCTCCTGCTGGAGGAGGAGGG - Intronic
980948434 4:139347034-139347056 TCGCACCTGTAGTGGGAGGCTGG - Intronic
985692195 5:1319619-1319641 CCTCTCCTGCACTAGTAGGATGG + Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
987674882 5:21062248-21062270 CCCCACCTGTAGGAGGTGGCTGG + Intergenic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
990011059 5:50998664-50998686 ACTCAGCTGGATTAGGAGGCAGG - Intergenic
1000198531 5:158985022-158985044 CCTCACCTGCCGTAGATGGGAGG - Intronic
1000577993 5:162999786-162999808 GCTCACCTACAGTAGTAGGAAGG + Intergenic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1004682749 6:17912417-17912439 CCTGACCTTCCGTAGGACGCAGG + Intronic
1006634566 6:35452622-35452644 CAGCGCCTGCAGCAGGAGGCGGG - Exonic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1011370574 6:86633183-86633205 ACTCACCTGTAGGAGGTGGCTGG + Intergenic
1013612302 6:111806644-111806666 CCTCACCTTCAATAGTGGGCCGG - Intronic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018426176 6:163684324-163684346 CCTAACCTCCAGTAGGACTCTGG - Intergenic
1019025848 6:168962412-168962434 CAACACCTGCAGCTGGAGGCTGG + Intergenic
1019053088 6:169199861-169199883 CCTCTCCAGCACTGGGAGGCAGG - Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1019720816 7:2569489-2569511 CCTCACCCTCAGCAGGAGGAGGG + Intronic
1019774701 7:2905705-2905727 CCTGACCTGCAGGAGGAAGCGGG + Intergenic
1022530086 7:31061542-31061564 CCTGACCCACAGGAGGAGGCTGG + Intronic
1024628084 7:51225481-51225503 CACCCCCTCCAGTAGGAGGCAGG + Intronic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1033401220 7:141027078-141027100 CCCCACCTGCAGTAGTAGAAGGG + Intergenic
1033718087 7:144024040-144024062 CACCACCTGCAGTCAGAGGCAGG + Intergenic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1036590913 8:10167198-10167220 ACTCAGCTGCAGTGGGAGCCCGG - Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1039517250 8:38144381-38144403 CCACCCCTGCAGTAGGAGGTAGG + Exonic
1039576226 8:38626077-38626099 CCTTTCCTGCAGGAGGAGCCTGG - Intergenic
1041669245 8:60476423-60476445 CCTCTCCTGAAATAGGAGGACGG - Intergenic
1043301823 8:78744001-78744023 ACGCACCTGCAGGAGGTGGCTGG + Intronic
1043377681 8:79668740-79668762 CCTCTCCCTCAGTAGGAGGAGGG - Intergenic
1043396560 8:79843050-79843072 ACACACCTGCAGGAGGTGGCTGG - Intergenic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1045490709 8:102666853-102666875 CCTCACCTCCAGTAGGCAGCTGG + Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049526697 8:143130447-143130469 CCACACGGGTAGTAGGAGGCAGG + Intergenic
1050355705 9:4780970-4780992 CCTCACCTTAAGTAGAAGGAAGG - Intergenic
1055261071 9:74434398-74434420 CCTCGGCTGCAGCTGGAGGCTGG - Intergenic
1056024778 9:82482499-82482521 GGTCACCTGCACTAGGTGGCTGG - Intergenic
1057645997 9:96875785-96875807 GCTCACCTGAAGTGGGACGCGGG - Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060998336 9:127887478-127887500 GCTCACCTGCAGTAGTTGGGGGG + Exonic
1061262779 9:129489127-129489149 CATCATCTGCAGTAGGACGGGGG + Intergenic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062013264 9:134278131-134278153 CCTCACCCATAGTGGGAGGCAGG - Intergenic
1062146598 9:134992815-134992837 TCACACATGGAGTAGGAGGCAGG + Intergenic
1062426828 9:136510005-136510027 CCACACCTGCGGGAGGGGGCCGG + Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187211989 X:17241077-17241099 CATCACCTGCAGTTGGAAGTGGG - Intergenic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1189041091 X:37542828-37542850 CAGCACCTGTAGTAGGAGACTGG + Intronic
1189236283 X:39489661-39489683 ACTCACCTGATGAAGGAGGCAGG + Intergenic
1189324126 X:40102770-40102792 CCTCGCCTGCAGCAGGAAGGTGG + Intronic
1192133280 X:68573249-68573271 CCTGACCTGCAAGAGCAGGCAGG - Intergenic
1195856691 X:109339310-109339332 ACACACCAGCAGGAGGAGGCTGG + Intergenic
1196022764 X:111007511-111007533 CCTCACCTGGAGGAGGCAGCTGG - Intronic
1197270857 X:124423549-124423571 CTTCACCTGGACTAGGAGTCAGG + Intronic
1200073915 X:153542037-153542059 CGTCACCTGCCTTAGGAGGCGGG + Intronic