ID: 1181802009

View in Genome Browser
Species Human (GRCh38)
Location 22:25353952-25353974
Sequence CTGACACACAGGTGCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181802005_1181802009 22 Left 1181802005 22:25353907-25353929 CCTCTATCCTCTCATCCTTCATC 0: 1
1: 1
2: 7
3: 56
4: 516
Right 1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 165
1181802006_1181802009 15 Left 1181802006 22:25353914-25353936 CCTCTCATCCTTCATCAGCAAAG 0: 2
1: 0
2: 0
3: 22
4: 233
Right 1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 165
1181802007_1181802009 7 Left 1181802007 22:25353922-25353944 CCTTCATCAGCAAAGATTTACTG 0: 1
1: 1
2: 0
3: 18
4: 235
Right 1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181802009 Original CRISPR CTGACACACAGGTGCAGCGC AGG Intronic
900630060 1:3630169-3630191 CAGGCCCACAGGTGCAGAGCCGG - Intergenic
904417761 1:30373574-30373596 CTGGCACACAGGAGATGCGCAGG - Intergenic
920925020 1:210332981-210333003 CTGAGACAAATGTGCAGTGCAGG + Intronic
920947847 1:210546453-210546475 CTGGCACAGAGGTGCAGAGGTGG + Intronic
922454911 1:225766918-225766940 CTGACACAGAAGTGTAGCCCTGG - Intergenic
923287264 1:232508445-232508467 CTGCCACACAGTTCCAGCACTGG + Intronic
924049754 1:240068969-240068991 CAGATAAACAGGTGGAGCGCAGG - Intronic
1065749145 10:28869598-28869620 CTAACACAAAGGTGGAGAGCTGG + Intronic
1066203044 10:33160260-33160282 CTGACAGACAGGTGTAGTGCTGG - Intergenic
1067043824 10:42973490-42973512 GTCACACACAGGTACAGGGCTGG - Intergenic
1067400115 10:45965031-45965053 CAGACACACAGCTGCAGGGAGGG - Intergenic
1067868445 10:49934323-49934345 CAGACACACAGCTGCAGGGAGGG - Intronic
1068024957 10:51631297-51631319 CTGAGACAAATGTGCAGTGCAGG + Intronic
1069992113 10:72322401-72322423 CTGAGTCTCAGGAGCAGCGCCGG - Intergenic
1071056704 10:81519988-81520010 CTGAGGCACAGGTGCAGAGCAGG + Intergenic
1074559340 10:114521161-114521183 CTGACCCACAGGTTCATCACAGG - Intronic
1075329062 10:121559472-121559494 CTGATTCACAGGTGCAGCCTGGG - Intronic
1076531245 10:131146595-131146617 CAGACAGACAGGTGCATCGTTGG + Exonic
1077196904 11:1285578-1285600 CAGACACAACGGCGCAGCGCAGG + Intronic
1081832716 11:46127574-46127596 CTAACAAACAGGTCCAGCCCAGG - Intergenic
1083862247 11:65427529-65427551 CTGACAAACGGGTGGAGTGCTGG + Intergenic
1083901023 11:65643577-65643599 CTGAAACACAGGAGCAGTACTGG + Intronic
1084008129 11:66333873-66333895 CTGACTCAAAGGGGCAGGGCAGG + Intronic
1084326679 11:68404313-68404335 CTGACAAGCAGGTGCAGTGTGGG - Intronic
1084955189 11:72687469-72687491 GTGACACACAGATGGAGCTCCGG - Exonic
1089212032 11:116810970-116810992 TGCACACACAGGTGCAGCGTGGG - Intergenic
1090263967 11:125342548-125342570 CAGACAAACAGCTCCAGCGCTGG - Intronic
1090805072 11:130197727-130197749 CAAACACACAGGAGCAGGGCAGG - Intronic
1091692531 12:2606770-2606792 ATGACACACAGGCAGAGCGCAGG - Intronic
1092055622 12:5506018-5506040 CTGACACACAGCTGGTGCCCAGG - Intronic
1092881136 12:12888617-12888639 CAGGGACACAGGTGCAGGGCCGG + Intergenic
1095859498 12:46900844-46900866 CCGGCACACAAGTGCAGCCCAGG + Intergenic
1101204361 12:102470657-102470679 CTGTCACACAGATGCATAGCAGG + Intronic
1102064666 12:109963949-109963971 CTGACTCAGAGCTGCAGCTCTGG + Intronic
1104384057 12:128334252-128334274 CTGACACTGAGGTGCAGCCTGGG - Intronic
1104725992 12:131076070-131076092 CTGGCACCCAGGAGCAGCCCAGG + Intronic
1104803507 12:131570532-131570554 CTGAGAAACAGATGCAGTGCAGG + Intergenic
1105599972 13:21878048-21878070 CTGACACACAGGATCATCACTGG + Intergenic
1106246206 13:27953062-27953084 CTGCCACACAGAAGCCGCGCTGG - Intergenic
1106303820 13:28493977-28493999 CTGACCCACAAGGGCAGCCCAGG - Intronic
1108497377 13:51039026-51039048 CTGAAATACAGCTGCAGCCCAGG + Intergenic
1110209258 13:72953250-72953272 CAGAGGCACAGGTGCAGTGCTGG - Intronic
1110471172 13:75861822-75861844 CTGCCTCAGAGGTGCAGAGCTGG + Intergenic
1112394211 13:99013728-99013750 CAGACACACAGGTGAAGAGAAGG + Intronic
1113267934 13:108640026-108640048 TAGACACACAGCTGCAGCTCAGG + Intronic
1114697938 14:24644842-24644864 CAGAGAGACAGGTGCAGTGCTGG + Intergenic
1118736698 14:68706086-68706108 CAGACCCACAGGGGCAGGGCAGG - Intronic
1120140774 14:80927260-80927282 CAGAGGCACAGGTGCAGTGCTGG + Intronic
1121173372 14:91872596-91872618 CTGGCAGACAGGTGCAGGCCAGG + Intronic
1121333831 14:93064594-93064616 CTGGGACACAGCTGCAGGGCCGG + Intronic
1122829036 14:104386735-104386757 CTGACAGACAGATGTAGAGCCGG + Intergenic
1123705034 15:22945083-22945105 GTGACACTGAGGTGCGGCGCTGG + Intronic
1123922229 15:25078406-25078428 CTTCCTCACAGGTGCAGCTCAGG - Intergenic
1125503266 15:40252568-40252590 CTTACACGTTGGTGCAGCGCCGG - Intronic
1126257438 15:46644206-46644228 CTGAAACAGAGCTGCAGAGCAGG - Intergenic
1127146971 15:56034879-56034901 CTGACACTCAGGAGCTGCCCTGG + Intergenic
1127752661 15:62060821-62060843 CTGATCCACAGGTGCAGGGGTGG - Intergenic
1128983215 15:72200973-72200995 CTGACACAGAGAGGCAGCCCTGG + Intronic
1131413764 15:92233301-92233323 CTGAGGCACAGTTGCAGTGCTGG + Intergenic
1132631127 16:917990-918012 AAGACATACAGGTGCAGAGCTGG + Intronic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1137799434 16:51248594-51248616 CTGTCACCCAGATGCAGTGCAGG + Intergenic
1139170490 16:64625502-64625524 CAGAGGCACAGGTGCAGTGCTGG - Intergenic
1140691937 16:77492968-77492990 CTGACACAAATGTGAAGTGCAGG + Intergenic
1141138625 16:81482838-81482860 CTGACTCACAGGGTCAGCCCTGG + Intronic
1142244590 16:88964019-88964041 CTACCTCACAGGTGCAGGGCTGG - Intronic
1142751026 17:1987689-1987711 CTCACACACATCTGCAGTGCAGG - Intronic
1144416577 17:15053496-15053518 CTGACACACAGCAGTAGCCCAGG - Intergenic
1151279678 17:73064142-73064164 CTGACACACAGATGAAGGGGAGG - Intronic
1151940411 17:77288301-77288323 CTGGTTCCCAGGTGCAGCGCTGG - Intronic
1151963445 17:77419379-77419401 CTGGGGCACAGGTACAGCGCCGG - Intronic
1158680444 18:59561799-59561821 CTCACACACAGCTGCACAGCCGG - Intronic
1161197931 19:2997466-2997488 CTGAGACACAGGAGTTGCGCTGG - Intergenic
1162231504 19:9270725-9270747 CTGACCCACAGCTGCAGACCTGG + Intergenic
1164743593 19:30594819-30594841 CTGGCACAGAGGAGCAGTGCAGG + Intronic
1165215090 19:34265355-34265377 TTGACACCCAGGAGCAGCACAGG - Intronic
1165347825 19:35259856-35259878 CAGACACCCAGGGGCAGGGCGGG + Intronic
1167380122 19:49133663-49133685 CTGACTCAAAGGTGCAGGGGAGG + Intronic
1168146326 19:54421583-54421605 CTCACACACAGGCCCAGCCCTGG + Intronic
925200936 2:1967454-1967476 CTGACTCACTGGTTCAGCCCCGG + Intronic
925586270 2:5467719-5467741 ATGACTCACAGGTGAATCGCTGG - Intergenic
927971390 2:27307910-27307932 TGGACACACAGGGGCAGCGCAGG + Intronic
928252807 2:29696746-29696768 CAGACACGCAGGTGCAGATCAGG - Intronic
932496907 2:72149983-72150005 CGAACACACAGGTGCGGCCCCGG - Intergenic
933199494 2:79432964-79432986 CTGACAAACAGGGACAGCCCAGG - Intronic
934686792 2:96327177-96327199 CAAACTCACAGGTGCAGGGCAGG - Exonic
935949722 2:108317543-108317565 CAGAGACACAGCTGCAGTGCTGG + Intergenic
936574324 2:113641012-113641034 CTAACACCCAGGTGCAGGGATGG - Intronic
943781638 2:191830589-191830611 TTGACACCCAGGGGCTGCGCAGG + Intergenic
944370292 2:198974371-198974393 CAGAAGCACAGGTGCAGTGCTGG + Intergenic
945521572 2:210833851-210833873 CAGAGGCACAGGTGCAGTGCTGG - Intergenic
946453777 2:219804020-219804042 TTGAGACACAGATGCAGCACTGG - Intergenic
948662280 2:239514975-239514997 CTGTCACACGGGGGCAGCGGCGG - Intergenic
948672726 2:239578821-239578843 CTGACTCAGGGGTGCAGGGCTGG - Exonic
948698280 2:239745113-239745135 CTGCCGCAAAGGCGCAGCGCAGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1174308533 20:49632267-49632289 GTGGCACACAGCTGCAGGGCAGG - Intergenic
1175548984 20:59803936-59803958 CTGAGAAACAGGTGCAGGGACGG - Intronic
1175695577 20:61100659-61100681 GTGATTCACAGGTGCAGAGCAGG + Intergenic
1177677227 21:24316372-24316394 CTGGCACTCAGGTGCAGGTCAGG - Intergenic
1179682441 21:43033105-43033127 CTGCTCCACAGGTGCAGGGCAGG - Exonic
1179771748 21:43624569-43624591 CTGACACAAAGGTGCTCTGCTGG + Intronic
1180618131 22:17141861-17141883 CTGACACTAAGGTACAGGGCCGG + Intronic
1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG + Intronic
1182269475 22:29144525-29144547 CTGTCACACAGGAGGACCGCTGG + Intronic
1182718269 22:32377174-32377196 CTGACACACAGGTGGGGAGGCGG + Intronic
1183225903 22:36549658-36549680 CAGCCACACAGGGGCAGAGCTGG - Intergenic
1183332912 22:37230948-37230970 CTCACACACAGGTGCTGCCCTGG + Intronic
1183356749 22:37363851-37363873 GTGACCCACAGGTGCAGGGTTGG + Intergenic
1183782328 22:40006879-40006901 CTGACACACAGGAGGTGCTCAGG - Intronic
1184424279 22:44400127-44400149 CTGGCACACAGGAGAAGCTCAGG - Intergenic
1184751326 22:46488108-46488130 CTGAAACTGAGGTGCAGGGCAGG - Intronic
1184795178 22:46728053-46728075 CCCACACACAGGGGCTGCGCAGG - Intronic
1185425848 22:50769876-50769898 CTAACACCCAGGTGCAGGGATGG + Intronic
949497012 3:4641719-4641741 CTGACACAAAGGTGGAGCTGAGG - Intronic
950170503 3:10835604-10835626 CAGCCACAGAGGGGCAGCGCAGG + Intronic
950193004 3:10991369-10991391 CTGGCACACAGGTGGAACTCGGG + Intergenic
950491126 3:13305707-13305729 CTGTCCCACTGGTGCAGCGGTGG + Intergenic
950536948 3:13584308-13584330 ATGACACAGAGGTCCAGTGCTGG + Intronic
954793923 3:53151886-53151908 CTGACACAGAGGTTCTGGGCTGG - Intergenic
954855678 3:53641847-53641869 CTGACCCACAGGTTCAGCGGTGG - Intronic
957921722 3:86757318-86757340 CAGAGACACAGTTGCAGTGCTGG - Intergenic
958510100 3:95037098-95037120 CAGAGACACAACTGCAGCGCTGG - Intergenic
960647401 3:119902750-119902772 CTGTCACACAGGTGGAGTACAGG + Intronic
961134235 3:124495173-124495195 CTGACACACAGAAGCACAGCTGG + Intronic
961823875 3:129588728-129588750 CAGACCCCCAGGTGCAGCCCTGG - Intronic
967832277 3:193930104-193930126 CTGACAAACAGCTGGAGCTCTGG + Intergenic
968052173 3:195662712-195662734 GTCACACACTGTTGCAGCGCAGG + Intergenic
968103638 3:195985626-195985648 GTCACACACTGTTGCAGCGCAGG - Intergenic
968301940 3:197623219-197623241 GTCACACACTGTTGCAGCGCAGG - Intergenic
968403337 4:317215-317237 CTGACACACAGCTGGAGAGAAGG - Intergenic
972018691 4:34280792-34280814 CAGAGACACAGGTGCAGTGCTGG - Intergenic
972712606 4:41612718-41612740 CTGACCCACATGTTCAGAGCAGG - Intronic
973005782 4:45005212-45005234 CTGACACAAAGGTACCCCGCTGG + Intergenic
977293441 4:95187818-95187840 GTGACACAAAGCTGCAGCACAGG + Intronic
987993693 5:25248018-25248040 AAGACACACAGGAGCAGGGCAGG + Intergenic
992120359 5:73586160-73586182 CTGCCACACAGGTGCTGTGGCGG + Intergenic
993784865 5:92117707-92117729 CAGACAAAGAGGTGCAGTGCAGG + Intergenic
996897110 5:128498057-128498079 CTGACACACTGGTCCAACTCTGG - Intronic
998133985 5:139665209-139665231 CTCACACACAGGCGCAGAGAGGG - Intronic
1000237652 5:159377264-159377286 CAGAGACACAGTTGCAGAGCTGG + Intergenic
1001210941 5:169809636-169809658 CTGAGCCACAGGTGTAGAGCAGG + Intronic
1003194957 6:3906314-3906336 CTGAAACACAGGTGTCCCGCTGG - Intergenic
1005009526 6:21322721-21322743 CTGCCAGAAAGGTGCAGAGCAGG + Intergenic
1005434591 6:25794931-25794953 CTGACACACTGCTGCAAAGCGGG - Intronic
1005599019 6:27407339-27407361 CCCACACACAGCTGCAGGGCTGG + Intergenic
1006845132 6:37056451-37056473 CTGACAAACAGGTCCTGCCCGGG + Intergenic
1007320734 6:41027390-41027412 CTGAAACACAGGTGCAGAGCGGG + Exonic
1013375399 6:109509731-109509753 CTGACCCACGGCTGCAGCTCTGG + Intronic
1013381214 6:109573223-109573245 CTGGCACACAGGAGCACAGCTGG - Intronic
1015455769 6:133424699-133424721 CTGACCCACAGCTGCAGACCTGG - Intronic
1016862250 6:148732417-148732439 GTGACACAAAGTTGCAGGGCTGG + Intergenic
1019742321 7:2680971-2680993 CTGACCCACAGGCGCCGGGCAGG + Intronic
1023510313 7:40945625-40945647 CAGAGCCACAGGTGCAGTGCTGG - Intergenic
1026019970 7:66698773-66698795 CTGACACAAAGCTGGAGCCCTGG - Intronic
1026880385 7:73903795-73903817 CTGACACAAAGCTGGAGCCCCGG + Intergenic
1032723171 7:134567460-134567482 CTGACACACAGGCTCAGTACAGG - Intronic
1038415876 8:27395573-27395595 CAGGCACAGAGGTGCAGAGCTGG - Intronic
1038428460 8:27480799-27480821 GTGACACAAAGGAGCAGGGCTGG - Intergenic
1041626489 8:60034713-60034735 CTGAAACACAAGTGGAGGGCTGG - Intergenic
1042493218 8:69426246-69426268 CTGACAAACACCTGCAGAGCAGG + Intergenic
1042840289 8:73116773-73116795 CTGGCACACAAGTGCAGAGGAGG + Intronic
1046497036 8:115027283-115027305 TTGACAAACACGTGGAGCGCTGG - Intergenic
1047022181 8:120786344-120786366 CAGAGATACAGGTGCAGTGCTGG + Intronic
1049332594 8:142063200-142063222 CTGGCAGGCAGGTGCAGCACTGG - Intergenic
1049810374 8:144565758-144565780 CTGACACATAACTGCAGTGCTGG + Intronic
1062032527 9:134368127-134368149 CAGAGACACAGGTGCATGGCAGG - Intronic
1187227989 X:17392384-17392406 CTAACACAGAGGTACAGTGCTGG + Intronic
1195334199 X:103832987-103833009 CTGACAGAGAGGTGGAGTGCAGG - Intergenic
1195901063 X:109797788-109797810 CAGACCCACTGGAGCAGCGCAGG - Intergenic
1197839895 X:130735042-130735064 CTGTCTCACAGGAGCAGTGCAGG + Intronic
1198836845 X:140815042-140815064 CAGAGACACAATTGCAGCGCTGG - Intergenic
1199332700 X:146581228-146581250 CAGAGACACAGTTGCAGTGCTGG - Intergenic