ID: 1181802770

View in Genome Browser
Species Human (GRCh38)
Location 22:25358223-25358245
Sequence ACCAGGGCTAGGAGGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 287}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181802766_1181802770 -8 Left 1181802766 22:25358208-25358230 CCTCAGACTCATGAAACCAGGGC 0: 2
1: 0
2: 4
3: 15
4: 270
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287
1181802762_1181802770 1 Left 1181802762 22:25358199-25358221 CCCTGGGATCCTCAGACTCATGA 0: 2
1: 0
2: 1
3: 21
4: 238
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287
1181802763_1181802770 0 Left 1181802763 22:25358200-25358222 CCTGGGATCCTCAGACTCATGAA 0: 2
1: 0
2: 1
3: 16
4: 198
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287
1181802760_1181802770 8 Left 1181802760 22:25358192-25358214 CCCATTTCCCTGGGATCCTCAGA 0: 1
1: 1
2: 2
3: 21
4: 231
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287
1181802761_1181802770 7 Left 1181802761 22:25358193-25358215 CCATTTCCCTGGGATCCTCAGAC No data
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287
1181802759_1181802770 9 Left 1181802759 22:25358191-25358213 CCCCATTTCCCTGGGATCCTCAG 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287
1181802758_1181802770 14 Left 1181802758 22:25358186-25358208 CCAAGCCCCATTTCCCTGGGATC 0: 1
1: 0
2: 6
3: 31
4: 319
Right 1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG 0: 1
1: 1
2: 1
3: 21
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181802770 Original CRISPR ACCAGGGCTAGGAGGGACCT TGG Intronic
900119086 1:1041000-1041022 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900119124 1:1041075-1041097 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900186484 1:1335536-1335558 GCCAGGGCAGGGAGGGACCATGG - Exonic
900482941 1:2908147-2908169 AGCAGGGCGGGGAGGGAGCTGGG - Intergenic
900614056 1:3556448-3556470 AGCAGGGGTAGGAGAAACCTCGG + Intronic
901154041 1:7123649-7123671 ACCAGGGCTCAGAGGGGCCAAGG - Intronic
902177061 1:14658272-14658294 ATCATAACTAGGAGGGACCTGGG + Intronic
902604776 1:17562946-17562968 ACCAGGGCAAGAGGGGCCCTGGG + Intronic
902623750 1:17665001-17665023 ACCAGGGCAAGGCAGGACCCAGG - Intronic
902687240 1:18086345-18086367 ACCAGTGGCAGGAAGGACCTGGG + Intergenic
903403993 1:23081028-23081050 TCCTGGGCTTGGAGGGGCCTGGG + Intronic
904041317 1:27586762-27586784 AGCAGGGCTTGGAGTGCCCTGGG - Intronic
904475573 1:30762564-30762586 ACCAGGGCCAGGAGGGAGCCGGG - Intergenic
905122243 1:35691067-35691089 AGCAGGGCTGGGAGGGAAATTGG + Intergenic
907300540 1:53483950-53483972 AGCAGGGGCAGGAGGGGCCTGGG + Intergenic
910151178 1:84148989-84149011 AGTAGGTCTAGGTGGGACCTGGG - Intronic
911632271 1:100196636-100196658 ACAAGGGATAGGAAGTACCTTGG - Intronic
912499972 1:110115160-110115182 AACAGGGGCAGGAGGGCCCTTGG - Intergenic
912562546 1:110560999-110561021 GCCAGGGCTGGGAGAGAACTGGG + Intergenic
915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG + Intergenic
915810023 1:158899102-158899124 ACCAGGGCTATGAGGGATAATGG + Intergenic
915990716 1:160512700-160512722 ACCAGGGTGGGGAGGGACCCAGG + Intronic
919526876 1:198664748-198664770 ATCAGGGTTATAAGGGACCTCGG - Intronic
919582332 1:199392009-199392031 AACATGGCAAGGAGGGAACTGGG - Intergenic
919755134 1:201061904-201061926 ACCATGTCCATGAGGGACCTAGG + Intronic
919881944 1:201906614-201906636 CCCAGGGCTGGAAGGGACCGGGG + Intronic
920254681 1:204646410-204646432 AACAGGGATAGTAGGCACCTGGG + Intronic
920347147 1:205313775-205313797 TGCAGGGCTAGGTGGGAGCTGGG + Intronic
920496681 1:206459930-206459952 ACCTGGCCAAGGAGGGAGCTGGG - Intronic
920530303 1:206697108-206697130 AACAGGAATAGGAGGGGCCTTGG - Intronic
923242524 1:232099489-232099511 AACAGGGTTAAGAGGGACCCAGG + Intergenic
923641305 1:235764027-235764049 ACAAGGCTTGGGAGGGACCTAGG - Intronic
924068767 1:240254544-240254566 GCCAGGGGTAGGGGGGACCTGGG - Intronic
1065103646 10:22357218-22357240 ACCCAGGCTTGGAGGGACATGGG - Intronic
1069900197 10:71702518-71702540 ACCAGGGCGAGAAGGGGCCAAGG - Intronic
1070540773 10:77413625-77413647 ACCAGCTCTAGGAAAGACCTGGG - Intronic
1070794117 10:79207141-79207163 GCCAGGGCAGGGAGGGGCCTAGG - Intronic
1070819368 10:79346023-79346045 TCCTGGCCTAGGAGGGGCCTAGG - Intergenic
1075353224 10:121745023-121745045 ACAAAAGCTAGAAGGGACCTGGG + Intronic
1075591025 10:123691816-123691838 AGCAGGGCCAGGCAGGACCTGGG + Exonic
1075591153 10:123692587-123692609 ACCTGGGCTGGGCCGGACCTGGG + Exonic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1076157661 10:128216031-128216053 ACCAGGGACAGCAGGGTCCTGGG + Intergenic
1076903776 10:133352343-133352365 ACCAGGGCGAGGAGAGGCCCCGG + Exonic
1077017722 11:404338-404360 CCCAGGGCAAGCAGGGACCCGGG + Intronic
1077028845 11:454283-454305 CCCAGGGCCAGGAGGGTGCTGGG + Intronic
1077251089 11:1561052-1561074 GCCAGGCCTAGCAGGGACCGAGG + Intronic
1077855157 11:6116422-6116444 TCCAGGGATGGGAGGGACCCAGG + Intergenic
1078290492 11:10005925-10005947 CACAGGGGTAGGAAGGACCTTGG + Intronic
1079276352 11:19040807-19040829 TCCAGGGATAGGAGGGACCCAGG + Intergenic
1080233307 11:30042223-30042245 ACCTGGGATGGGAAGGACCTGGG + Intergenic
1083057509 11:59837172-59837194 ACCAGGACTACAAGTGACCTGGG + Exonic
1083160389 11:60850686-60850708 TCCAGGCCTGGGATGGACCTAGG - Exonic
1083519599 11:63296079-63296101 ACAAGGGATAGGCGTGACCTGGG + Intronic
1084162030 11:67355266-67355288 ACCAGGGCTGGGAAGGGCCTAGG + Intronic
1084323937 11:68388360-68388382 ACCAGGGCTAGGAGGGGCCTTGG - Intronic
1084428749 11:69099944-69099966 GTCAGGCCTGGGAGGGACCTGGG + Intergenic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1084694955 11:70747316-70747338 AGCAGGGATGGGAGGGACCCGGG + Intronic
1087277999 11:96179694-96179716 ATGTGGTCTAGGAGGGACCTGGG + Intronic
1088693898 11:112349946-112349968 TCCAGCTCTGGGAGGGACCTGGG + Intergenic
1088707320 11:112475575-112475597 ATCAGTGCTAGGAAGGCCCTGGG - Intergenic
1089008543 11:115113569-115113591 AATAGCTCTAGGAGGGACCTTGG - Intergenic
1089895908 11:121929848-121929870 ACCACAGCCAAGAGGGACCTGGG + Intergenic
1090081448 11:123615869-123615891 ACAAGGTCTAGGACGGTCCTGGG + Intronic
1090188623 11:124753832-124753854 ACCAGGCCTGGGAGGGCCATGGG + Exonic
1090644638 11:128757907-128757929 ACCTGGGTGAGGAGGGACTTTGG - Intronic
1090646806 11:128773004-128773026 CCCAGGGCTGGGAGGAAGCTTGG + Intronic
1091082465 11:132683787-132683809 AGCAGGTCTCAGAGGGACCTTGG + Intronic
1091173787 11:133541880-133541902 GCCCGGGCTAGGTGGAACCTAGG - Intergenic
1091280603 11:134379713-134379735 ACCAGGGGCAGGAGGGAGTTAGG + Intronic
1095788065 12:46132496-46132518 ACAAGGACTAGGGGAGACCTTGG + Intergenic
1096524153 12:52200714-52200736 AACAGTGCCAGGAGGGATCTGGG + Intergenic
1097585932 12:61516245-61516267 ACTTGGGGTAGGAGGGATCTGGG - Intergenic
1098281695 12:68868555-68868577 ACCCGGGGTAGGAGGGACCTAGG - Intronic
1098723237 12:73928572-73928594 ACAAGGGATATGAAGGACCTAGG + Intergenic
1100640067 12:96474056-96474078 TCCAGGGCTAGAAGGACCCTAGG + Intergenic
1100868777 12:98888405-98888427 ACCAGGGCTAGGATGGACACAGG - Intronic
1101488836 12:105193322-105193344 ATCAGAGCTAGAAGGGTCCTAGG + Intronic
1101817562 12:108157474-108157496 TCCAGGGGTAGGAGGGAAATAGG - Intronic
1103128783 12:118448443-118448465 CCCAGGGCTAGCAGGGGCCAAGG + Intergenic
1103162768 12:118743930-118743952 ACCAGGTGAGGGAGGGACCTAGG + Intergenic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1104421586 12:128640461-128640483 CCCAGGGCTGGGAGGGACTGGGG + Intronic
1105249366 13:18683778-18683800 GAAAGGGCCAGGAGGGACCTTGG + Intergenic
1106100763 13:26694029-26694051 ACCAGGGACAGGAGGGACACAGG - Intergenic
1107867455 13:44716631-44716653 ACCAAGGCTAGAAGCTACCTGGG - Intergenic
1109123600 13:58489038-58489060 ACCCAGGCTAGGCGGGACCCAGG + Intergenic
1111093804 13:83482894-83482916 ACCAGGGCTGGGAGGCATGTTGG + Intergenic
1112474087 13:99715186-99715208 GCCAAGGCTAGGAGGCAACTGGG + Intronic
1112496024 13:99905463-99905485 AACAGGGCCAGAAGGGCCCTAGG - Intergenic
1113572791 13:111370721-111370743 CCCAGGGCTGGGAAGGACGTGGG - Intergenic
1113727690 13:112617551-112617573 CACAGGACTAGGAGGAACCTGGG + Intergenic
1113826248 13:113256294-113256316 ACCAGGGCTGGCAGTGCCCTCGG + Intronic
1116484230 14:45427651-45427673 ACCAGGGAAAAGAGGGACCTGGG + Intergenic
1119773929 14:77237104-77237126 GGCAGGGATAGGAGGTACCTGGG - Intronic
1120521246 14:85530384-85530406 ACGATGGGCAGGAGGGACCTCGG + Exonic
1122280526 14:100619754-100619776 ACTAGAGATAGGAGTGACCTGGG + Intergenic
1122442434 14:101741268-101741290 GCCATGGCTAGAAGGGACCAAGG - Intergenic
1122800456 14:104226869-104226891 ACAAGGGCTATGAGGAACCAGGG - Intergenic
1122931850 14:104936718-104936740 ACCTAGGCCAGGAGGGAGCTGGG + Exonic
1124202039 15:27686909-27686931 ACCAGGGGTAGGAGGGTCAGAGG - Intergenic
1126299923 15:47184206-47184228 ACCAGGACTAGGAGGCAGCGGGG + Intronic
1127344209 15:58078384-58078406 AGCAGGCCCAGGAGGAACCTGGG - Intronic
1127925576 15:63537507-63537529 ACCAGGGACAGGAGGAACATGGG - Intronic
1128224888 15:65994655-65994677 GCCAGGGGCAGGAGGGACCTGGG + Intronic
1128554313 15:68620797-68620819 ACCAGGGCTAGAAGGTTTCTAGG + Intronic
1128787437 15:70408420-70408442 ACCAGGGGAAGGAGAGATCTAGG + Intergenic
1129275042 15:74439728-74439750 ATCAGAGCTGGGAGGGTCCTGGG - Intergenic
1135472864 16:22747385-22747407 AACAGGTCTGGGATGGACCTTGG - Intergenic
1136022483 16:27448971-27448993 CCCTGGGCTAGGAGGGCCCCTGG + Exonic
1136686335 16:31996914-31996936 GCCAGCTCAAGGAGGGACCTAGG - Intergenic
1136786948 16:32940443-32940465 GCCAGCTCAAGGAGGGACCTAGG - Intergenic
1136882825 16:33913346-33913368 GCCAGCTCAAGGAGGGACCTAGG + Intergenic
1138386826 16:56641183-56641205 TTCAGAGCTAGAAGGGACCTTGG + Intronic
1138679060 16:58672054-58672076 ACAGGGGCTAGGAGGGGCCCTGG + Intronic
1139275947 16:65727831-65727853 ACTGGAGCTGGGAGGGACCTTGG - Intergenic
1141587121 16:85041740-85041762 ACCCGGGGAAGGAGGGACCCTGG + Intronic
1141620314 16:85233889-85233911 GGCAGGGGTAGGAGGGCCCTGGG - Intergenic
1203089184 16_KI270728v1_random:1202113-1202135 GCCAGCTCAAGGAGGGACCTAGG - Intergenic
1143868778 17:9943092-9943114 CCCAGGGCTGGGAGGGGCCCAGG + Intronic
1144652640 17:17017164-17017186 GCCAGGGCCAGCAGGGCCCTTGG + Intergenic
1144653599 17:17021723-17021745 AGCAGAGCTAGGCAGGACCTTGG + Intergenic
1147884637 17:43676398-43676420 ACCCGGGATGGGAGGGAGCTGGG - Intergenic
1147911673 17:43859720-43859742 GGCAGGGCTAGGAGGGACAAGGG + Intronic
1148044970 17:44737953-44737975 CAAAGGGCTAGGAAGGACCTGGG + Intronic
1148085667 17:44992451-44992473 GTCAGGGCTTGCAGGGACCTGGG + Intergenic
1148111134 17:45145038-45145060 CCCAGGGGTAGGAAGGTCCTAGG - Intergenic
1148456281 17:47813208-47813230 TCTGGGGCAAGGAGGGACCTGGG - Intronic
1149353643 17:55817198-55817220 GCCAGGGCTTGGAGGGAAATTGG + Intronic
1149415676 17:56457511-56457533 ACCAGGGCTGAAAAGGACCTTGG - Intronic
1150666076 17:67139799-67139821 ACCTGGAATAGGAGGGAGCTAGG - Intronic
1151337261 17:73447327-73447349 AGCAGGGCTACCAGGGACCCAGG - Intronic
1151682081 17:75627585-75627607 GCCAGGGCCAGGAGGCACTTGGG - Intronic
1151718389 17:75842971-75842993 CCCTGGGCAAGGAGGGGCCTGGG - Intronic
1152057317 17:78040025-78040047 ACCAGGGCTGGGAGGCACCCTGG - Intronic
1155425606 18:25703573-25703595 ACCAAGGCTAGTAGTGTCCTGGG - Intergenic
1156041774 18:32831047-32831069 ATGAGGGCTCGGAGGGAGCTGGG + Intergenic
1156476464 18:37408868-37408890 ACCAGAGCTAGGAGAGAGGTGGG - Intronic
1159770826 18:72543753-72543775 CCCAGGGGTTGGAGGCACCTGGG - Intronic
1160218810 18:76957416-76957438 ACCAGCCCCTGGAGGGACCTGGG - Intronic
1161033856 19:2073064-2073086 CCCAGGGCAAGGAGTGACCCTGG + Exonic
1163374374 19:16921434-16921456 ACCAGGGCAGGGAGGGCCCCTGG - Intronic
1163584859 19:18157952-18157974 GCCAGGGCTGGGAGGGGGCTGGG + Intronic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1164839422 19:31381188-31381210 ACCACGGAAAGGAGAGACCTGGG + Intergenic
1168003506 19:53467697-53467719 GCCAGGCCTGGGCGGGACCTGGG - Intergenic
1168152967 19:54458826-54458848 CCCAGGGCAAGGAGTGAACTAGG - Intronic
1168359592 19:55727829-55727851 ACCAAAGCTAGGAGTGATCTTGG - Intronic
1168363225 19:55760714-55760736 ACAAGGACAAGGAGGAACCTGGG - Intronic
1168364174 19:55770716-55770738 ACAAGGACAAGGAGGAACCTGGG - Intronic
925498566 2:4479721-4479743 ACCAGGGCTCAAAGGGACCCAGG - Intergenic
926295300 2:11564645-11564667 CACTGGGCTGGGAGGGACCTAGG + Intronic
926331223 2:11827635-11827657 ACCAGGGCAGGGAGGGATCCCGG - Intergenic
926700654 2:15801116-15801138 ACCAAGGCTTGGAGAGACCCAGG - Intergenic
927544554 2:23940836-23940858 ACCTGGGCTGGGCGGGACCCTGG - Intronic
927783485 2:25956734-25956756 ACCAGGGCTAGGAGGAGGATGGG + Intronic
928258118 2:29742510-29742532 ATCAGAGCCAGGAAGGACCTTGG - Intronic
929033801 2:37672164-37672186 GCCCGGGCTGAGAGGGACCTGGG - Exonic
930250554 2:49029851-49029873 TCCAGGGCTAGCAGGGACCCTGG - Intronic
934746603 2:96763569-96763591 CCTAGGGCTTGGAGGGACTTCGG + Intronic
936982437 2:118276928-118276950 ACCAGGGCTGGGAGGCACACAGG - Intergenic
938661819 2:133494732-133494754 ACCAGAGCTAGGCTGGAACTGGG - Intronic
939868694 2:147503880-147503902 ACCAGGACTAGGATGGCCTTTGG - Intergenic
942303737 2:174586541-174586563 ACCAGGGCCAGGAGAGACGATGG + Intronic
942386232 2:175446357-175446379 GCCAGGGGAAGGAGGGACTTCGG - Intergenic
945714195 2:213337064-213337086 TCCAGGGGTGGGAGGGACCCAGG + Intronic
947831853 2:233146968-233146990 ACCAGGTCTAGAACGGACTTTGG - Intronic
948301157 2:236908544-236908566 GCCATGGCTATGATGGACCTTGG - Intergenic
948747513 2:240107178-240107200 ACGTGGGCTAAGAGGGACTTGGG + Intergenic
1172126108 20:32626252-32626274 ACCAGAGCCAAAAGGGACCTTGG + Intergenic
1172275446 20:33676711-33676733 GACAGGGCTTGGAGGGACCAGGG - Exonic
1172460973 20:35118484-35118506 ATCAGCACTAGAAGGGACCTTGG - Intronic
1172481544 20:35274696-35274718 ACCAGGGCCAGCAGGGCCCTAGG + Exonic
1172890475 20:38260587-38260609 TCCAGGGCTAGGCGGGACCGAGG - Exonic
1173167454 20:40695507-40695529 CCCAGGCCTTGGAGGGACTTGGG + Intergenic
1173576089 20:44113681-44113703 GCCAGGGCCAGGAGAGGCCTCGG - Intronic
1173607963 20:44345391-44345413 ACCAAGGCAAAGAGGGCCCTGGG + Intronic
1173764483 20:45595317-45595339 TCCAGGGATGGGAGGGACCCAGG - Intergenic
1174133157 20:48359946-48359968 CCCCGGGGTAGGAGAGACCTTGG - Intergenic
1175422639 20:58844505-58844527 ACCATGGCTAGAAGCAACCTGGG - Intronic
1175985906 20:62764058-62764080 AGCAGGGCTGGGAGGGGTCTGGG + Intergenic
1176017666 20:62944349-62944371 ACCCGGGGGAAGAGGGACCTGGG - Intronic
1176456219 21:6914295-6914317 GAAAGGGCCAGGAGGGACCTTGG + Intergenic
1176834393 21:13779344-13779366 GAAAGGGCCAGGAGGGACCTTGG + Intergenic
1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG + Intronic
1180082503 21:45493294-45493316 ACCACTGTTGGGAGGGACCTGGG + Intronic
1180758583 22:18181134-18181156 ACCAGGGCCAGGGGAGGCCTTGG + Intergenic
1180768870 22:18364926-18364948 ACCAGGGCCAGGGGAGGCCTTGG + Intergenic
1180777442 22:18497469-18497491 ACCAGGGCCAGGGGAGGCCTTGG - Intergenic
1180810162 22:18754779-18754801 ACCAGGGCCAGGGGAGGCCTTGG - Intergenic
1180826745 22:18868150-18868172 ACCAGGGCCAGGGGAGGCCTTGG + Intergenic
1180887072 22:19253405-19253427 GCCAGGGCAGGGAGGGACCGTGG - Intronic
1180895921 22:19331957-19331979 CCCAGGGCAAGGATGCACCTGGG + Intronic
1181196306 22:21189031-21189053 ACCAGGGCCAGGGGAGGCCTTGG - Intergenic
1181213221 22:21304093-21304115 ACCAGGGCCAGGGGAGGCCTTGG + Intergenic
1181456646 22:23063765-23063787 CCCAGGGGTAGGAGGGAGCTGGG - Intronic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1182902670 22:33911302-33911324 ACCAAGGCTGGAAGAGACCTTGG - Intronic
1183281611 22:36935505-36935527 AGCAGGGCCTGGAGGGAGCTGGG - Intronic
1184004427 22:41697926-41697948 CCCAGGGCCAGGAGGCACCTGGG + Exonic
1184283360 22:43451801-43451823 GCCAGGCCTAGTAGGGACCATGG - Intronic
1184427978 22:44424190-44424212 CCCTGGGCTAGCAGGTACCTGGG + Intergenic
1184644497 22:45888825-45888847 ACCCGGGCAAGGAGGGACTGCGG - Intergenic
1184942386 22:47778539-47778561 ACCAGTGCCAGGAGAGTCCTGGG + Intergenic
1185015216 22:48338931-48338953 ACCTGGGCTGGGAGGGAGGTGGG - Intergenic
1203230492 22_KI270731v1_random:105810-105832 ACCAGGGCCAGGGGAGGCCTTGG + Intergenic
1203276886 22_KI270734v1_random:94060-94082 ACCAGGGCCAGGGGAGGCCTTGG + Intergenic
949397575 3:3631204-3631226 CCCAGGGATAGCAGGGACCAGGG - Intergenic
949901746 3:8820869-8820891 ACCAGTGCTAGAAGAGATCTAGG + Intronic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
950495176 3:13329364-13329386 ACCAGGGGAAGGAGGGAAATGGG + Intronic
953269334 3:41424611-41424633 TCCAGGTGTGGGAGGGACCTAGG + Intronic
953418925 3:42739838-42739860 AGCAGGGCTGTGTGGGACCTTGG + Intronic
954225065 3:49176030-49176052 CCCAGGGCAAGGATGGAGCTAGG - Exonic
954366339 3:50148153-50148175 CTCAGGACTAGGAGAGACCTAGG - Intergenic
954579624 3:51696253-51696275 GCCAGGGCTAGGAGGACCCCAGG + Intronic
954615156 3:51965801-51965823 ACCAGGACTAGGAGCTCCCTAGG + Intronic
954638742 3:52085556-52085578 GCCAGGGCAAGGAGGCTCCTAGG - Intronic
954867142 3:53739287-53739309 ACCAGAGCTAGAAGGGACTGTGG - Intronic
956119617 3:65953500-65953522 AACTGGGCTCGGAGGGACCCAGG - Intronic
958043016 3:88248630-88248652 TCCAGGGCCAGGAGTGAGCTTGG + Intergenic
958483721 3:94676875-94676897 TCCAGGGATGGGAGGGACCCAGG + Intergenic
961124614 3:124405581-124405603 AACAGGGTTGGGAGGGATCTTGG - Intronic
961475287 3:127142140-127142162 ACCAGGCCAAGCAGGAACCTTGG + Intergenic
967091023 3:186134866-186134888 AGCAGGGCTTGGAGAAACCTTGG + Intronic
968573419 4:1354094-1354116 ACCAGGGCCAGGAGGCAGCCGGG + Intronic
969538481 4:7771014-7771036 CCAAGGGCTAGGAGGTGCCTTGG - Intronic
969593471 4:8134727-8134749 AGCTGGGCTCGGAGGGACCAGGG + Intronic
972968726 4:44545650-44545672 ATCAGGGCCAGTAGGAACCTTGG - Intergenic
973712400 4:53642832-53642854 GCCATGGCTGGGAGGGATCTGGG - Intronic
974401498 4:61413430-61413452 GGCAGGGCTAGTGGGGACCTTGG - Intronic
979742488 4:124168339-124168361 TCCAGGGGTAGAAGGGACCCAGG + Intergenic
982277596 4:153652324-153652346 TCAGGGGCTAGGAGAGACCTAGG + Intergenic
982859736 4:160434254-160434276 TCCAGGGAAAGGAGGGACCCAGG - Intergenic
984964393 4:185127935-185127957 ACCAGGGCTTGGAAGACCCTCGG + Intergenic
991594546 5:68288998-68289020 GCCAGGGCTTGGAGAGACCATGG + Intronic
993482647 5:88443808-88443830 ACCTGTGCTAGGAGTGACCTAGG - Intergenic
994298887 5:98122220-98122242 TCCAGGTGTAGGAGGGACCCAGG + Intergenic
998388686 5:141773204-141773226 ACCAGGGCAAGGGGGAACTTGGG - Intergenic
1000109802 5:158097492-158097514 ACCAGGGATAGCAGGGAGTTGGG + Intergenic
1001220867 5:169899594-169899616 AGCAGGACTAGGAAGGCCCTGGG + Intronic
1001871486 5:175159845-175159867 ACCCGGGGCAGGAGTGACCTGGG - Intergenic
1002060180 5:176621181-176621203 AGCAGGGCTGGGCGGGACTTTGG - Intronic
1004183925 6:13405939-13405961 TCCAGGGCCAGGAGGAGCCTGGG + Intronic
1004344554 6:14836652-14836674 ACCAGGGCGAGGATGGAACAGGG + Intergenic
1005322365 6:24667582-24667604 TCCAAGGCTGGGAGGGACTTTGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006795797 6:36731655-36731677 ACCAGGTCCTGGAGGGATCTGGG - Intronic
1007747500 6:44051904-44051926 AGCCGGGCAAGGAGGGAGCTGGG - Intergenic
1008492749 6:52103146-52103168 ACCACTGCTAGGTGGCACCTTGG + Intergenic
1009890383 6:69673563-69673585 ACCTGGGGGAGGAGGGACCTAGG + Intergenic
1009942236 6:70303043-70303065 ACCGGGGGCAGGAGGGACCAAGG - Exonic
1013457166 6:110340496-110340518 CCCTGGGCTAGGGGAGACCTAGG + Intronic
1013490812 6:110644743-110644765 ACCAGAGGAAGGAGGGACTTGGG - Intronic
1016958427 6:149648840-149648862 ACCAGGGATAGTATAGACCTTGG + Intronic
1017078231 6:150639920-150639942 TTTAGGGCTAGAAGGGACCTCGG + Intronic
1017724824 6:157269615-157269637 ACCACGGCAGGGAGGGGCCTGGG - Intergenic
1018387732 6:163320150-163320172 TCCAGGGCCCGGAAGGACCTTGG + Intergenic
1019184120 6:170211141-170211163 ACCAGGGCCAGGTAGGGCCTTGG - Intergenic
1019414527 7:921179-921201 TCCAGGGGTGGGAGGGACCCTGG - Intronic
1022140715 7:27491304-27491326 TCCAGGCCTGGGATGGACCTAGG + Intergenic
1022443975 7:30455084-30455106 ACCAGTGCAAGCAGGGCCCTGGG - Intronic
1022964804 7:35462576-35462598 AGAAGGTCTAGGAGGGACCCTGG + Intergenic
1023238933 7:38121580-38121602 ACCAGGACTGGGAGGGACTTGGG + Intergenic
1023864454 7:44232220-44232242 CCCAGGCCTAGGTGGGAGCTGGG + Intronic
1024215568 7:47245643-47245665 ACCAGGGCCATGGGGGACGTGGG - Intergenic
1024395789 7:48865106-48865128 ACAAGGGCTAGGCTGGACTTTGG - Intergenic
1024399447 7:48907170-48907192 ACAAGGGCTAGGCTGGACTTTGG + Intergenic
1025110956 7:56215720-56215742 ACCTGGGCTAGAAAGGACATAGG + Intergenic
1029506633 7:100967022-100967044 ACCAGGGCAGGGAGGGGGCTGGG + Intronic
1030211069 7:106996288-106996310 GCCAGGGCCAGGAGGGACTCTGG - Intergenic
1031332325 7:120481482-120481504 ACCAGGGATAGAAGGGATCAAGG + Intronic
1031978833 7:128111126-128111148 ACCAGGTGTAGGAGGGAAGTGGG + Intergenic
1032239386 7:130149241-130149263 ACCAGGTTTGGGAGAGACCTTGG + Intergenic
1032962386 7:137051513-137051535 ACCAGGTCTAGGAAAGTCCTTGG - Intergenic
1033603846 7:142910673-142910695 TCCTGAGCTAGGAGGGAACTTGG - Intronic
1035337181 7:158137533-158137555 ACCATGGCTAGGAGGGATGCAGG - Intronic
1036482245 8:9149980-9150002 GTCAGGGCCAGCAGGGACCTTGG - Intronic
1037153766 8:15674169-15674191 ACCATGGATGGGAGGGACATTGG - Intronic
1039212965 8:35236423-35236445 TCCAGGGCTGGCTGGGACCTCGG - Intronic
1047179376 8:122572598-122572620 AACAAGGCTTGGATGGACCTAGG - Intergenic
1048861427 8:138727005-138727027 ACCAGGGCTGGGAGGGAGAGTGG + Intronic
1049403725 8:142442504-142442526 GCCAGGGCCAGGAGGAACCTGGG + Intergenic
1049446854 8:142635187-142635209 CCCAGGGCTGGGCGGGAGCTGGG - Intergenic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1049795952 8:144497325-144497347 CCCAGGGCAAGAAGGGTCCTGGG + Exonic
1051849933 9:21494625-21494647 ACTAGGCATAGGAGGGATCTAGG - Intergenic
1051888790 9:21922803-21922825 TACAGGGGTAGGAAGGACCTTGG + Intronic
1052851601 9:33381594-33381616 ACCAGGGCTGGGAGTGACCAGGG - Intergenic
1053351869 9:37418502-37418524 ACCAGGGCCAGGAGGGGACACGG + Intergenic
1057806735 9:98224981-98225003 AAGAGGGCTGGGAGGTACCTTGG - Intronic
1058301449 9:103378769-103378791 AGCAGGGCTAGGATTGGCCTGGG - Intergenic
1060034077 9:120240135-120240157 ACGAGAGGCAGGAGGGACCTGGG - Intergenic
1060269943 9:122133176-122133198 ATCTGGGATCGGAGGGACCTGGG - Intergenic
1062459637 9:136657507-136657529 ACCAGGGCATGGAGGGTCTTCGG - Intergenic
1185848736 X:3465248-3465270 AGCAGGGTTGGGAGGGCCCTGGG - Intergenic
1187137059 X:16558253-16558275 ACCAGGTAGAGGAGGGAACTAGG - Intergenic
1189250585 X:39598268-39598290 CCCAGGGAGAGGTGGGACCTTGG + Intergenic
1189320310 X:40083543-40083565 ACCTGGGCTGGGAGTGAACTTGG + Intronic
1189815764 X:44822942-44822964 ACCAGGGCTAAAAGGGGCCAAGG + Intergenic
1190072776 X:47292595-47292617 TCCAGGGGAAGGAGAGACCTGGG + Intergenic
1190277739 X:48910086-48910108 GCCATGGCTAGGAGGGTCCTGGG - Intronic
1192169028 X:68843131-68843153 ACCCGGGCTATGAGGGAAGTGGG + Intergenic
1196866663 X:120077023-120077045 ACCAGAGCGAGAAGGAACCTGGG - Exonic
1196876436 X:120159258-120159280 ACCAGAGCGAGAAGGAACCTGGG + Exonic
1199041808 X:143123054-143123076 ACATGTGGTAGGAGGGACCTAGG + Intergenic
1199620670 X:149697590-149697612 ACCAGGGGTAGGGGGTTCCTAGG + Intronic
1200092174 X:153641160-153641182 AGCACAGCTAGGAGGGTCCTTGG + Intergenic
1200455296 Y:3383223-3383245 ACTAGGCCTAGGTGGGAACTAGG + Intergenic
1200814907 Y:7521582-7521604 AGCAGGGTTGGGAGGGCCCTGGG + Intergenic