ID: 1181802774

View in Genome Browser
Species Human (GRCh38)
Location 22:25358255-25358277
Sequence CTGTGAAAGAGGAAGGGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181802774_1181802782 2 Left 1181802774 22:25358255-25358277 CCCCGTCCCTTCCTCTTTCACAG 0: 1
1: 0
2: 3
3: 42
4: 401
Right 1181802782 22:25358280-25358302 GAGGACACTGAGGCCCATAGAGG No data
1181802774_1181802781 -8 Left 1181802774 22:25358255-25358277 CCCCGTCCCTTCCTCTTTCACAG 0: 1
1: 0
2: 3
3: 42
4: 401
Right 1181802781 22:25358270-25358292 TTTCACAGATGAGGACACTGAGG 0: 7
1: 292
2: 2162
3: 7201
4: 15048

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181802774 Original CRISPR CTGTGAAAGAGGAAGGGACG GGG (reversed) Intronic
900382745 1:2392872-2392894 TTGGGAAGGAGGAAGAGACGGGG + Intronic
900620297 1:3583965-3583987 CTGTGAATGAGGGAGAGGCGTGG - Intronic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
900968799 1:5977866-5977888 CGGTGAAAGGGAAAGGGAGGGGG + Intronic
901004232 1:6164104-6164126 CTGGGAAGGAGGAAGGGTGGCGG - Intronic
901865711 1:12105370-12105392 CTGTGAAGGATGAGGGAACGAGG - Intronic
902605674 1:17567949-17567971 CTTTAAAAGAGGAAGGGGCTGGG + Intronic
902997081 1:20234521-20234543 CTGTGAAAGGGAAAAGGACATGG + Intergenic
903421499 1:23220535-23220557 CAAAGAAAGAGCAAGGGACGTGG + Intergenic
904328047 1:29740148-29740170 CTGAGAAGAAAGAAGGGACGAGG + Intergenic
904439559 1:30521563-30521585 CTGTGAACCAGGCAGGGATGGGG - Intergenic
904532760 1:31180269-31180291 CTGTGAAAGAGGCATGGCCCTGG - Exonic
904879994 1:33689108-33689130 GTGGGAAAGAAGAAGGGAAGGGG + Intronic
905628993 1:39508425-39508447 CTGTGAAAGGGCAGGGGCCGTGG - Intronic
905637247 1:39562508-39562530 ATGTGAAAGAGGAGAGGAGGTGG + Intronic
906287500 1:44596982-44597004 GTGGGAGAGAGGAAGGGAGGAGG + Intronic
906312401 1:44763256-44763278 CTGTGGAAGAGCAAGTGACTGGG + Intronic
907109194 1:51911083-51911105 CTGAGAAATAGGAACGGATGTGG + Exonic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
912857875 1:113187874-113187896 GGGTGAAAGAGGAAAGGACTGGG - Intergenic
913311934 1:117507415-117507437 CTGAGAAAGAGGATTGGAAGTGG - Intronic
914817222 1:151071770-151071792 CTGTGAAAGAAGCAGAGGCGAGG - Intronic
915426821 1:155834122-155834144 CAGTTAAAGAGGAAGGAATGGGG - Intronic
916520931 1:165563022-165563044 CTGCTAAAGAGAAAGGGACAAGG + Intronic
916554247 1:165879864-165879886 CTCTGAAAAAGGAACGGAAGTGG + Intronic
917253416 1:173088071-173088093 AAGTGAAAGAAGAAGGGATGTGG + Intergenic
917736647 1:177927216-177927238 CTGTGCACTAGGAAGGGAGGAGG - Intronic
918013675 1:180611492-180611514 CTGCTAAAGAGGAAGTGACATGG + Intergenic
918688455 1:187448717-187448739 CTGTGAAAGACCAAGTGACCTGG + Intergenic
920070073 1:203296453-203296475 CTGGGGAAGGGGAAGAGACGTGG - Intergenic
920724754 1:208423671-208423693 CAGGGAAAGAGGAAGGGGCGGGG + Intergenic
920886054 1:209929107-209929129 CAGAAAAAGAGGAAGGGAGGAGG - Intergenic
920965131 1:210694978-210695000 CTGAGAATGAGAAAGGGAAGGGG + Intronic
921940142 1:220830664-220830686 CTGAGAAAGGGGAAGTGACTTGG - Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
923672478 1:236052492-236052514 GTGAGAAAGAGGAAGGAACCAGG - Intronic
1063827725 10:9917166-9917188 CTATGAATGAGGAAGAGAAGAGG + Intergenic
1064314959 10:14246865-14246887 GTGTGAGACAGGAAGGGAAGGGG + Intronic
1065138112 10:22692564-22692586 CTGTGAAAGGGGTAGGCACTTGG + Intronic
1065527561 10:26638329-26638351 CAGGGAAAGAGGAAGGGGTGGGG - Intergenic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1072208707 10:93226624-93226646 ATGTGGAAGAGGAAGGGTCCTGG + Intergenic
1072248899 10:93566631-93566653 CGGGGAAAGAGGGAGGGAGGCGG - Intergenic
1073322097 10:102621622-102621644 CAGTGGAGGAGGCAGGGACGGGG - Intronic
1073857830 10:107697631-107697653 CATTAAAAGAGGAAGGGAGGAGG - Intergenic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1075007105 10:118839107-118839129 CTGGGGAGGAGGAAGGGATGGGG + Intergenic
1075257841 10:120939498-120939520 CAGGGAAGGAGGAAGGGAGGGGG - Intergenic
1075627615 10:123973855-123973877 CTGTGAAAGAGGACAGGGCGCGG - Intergenic
1075764336 10:124880562-124880584 CTGTGACAGAGGTGGGCACGGGG - Intergenic
1076188041 10:128464135-128464157 CTCTGACAGGGGAAGGGACCAGG - Intergenic
1077073705 11:690219-690241 CTGTCAAAAAGGAAGGGGAGGGG + Intronic
1077473152 11:2774283-2774305 CTGTGATAGAGGCAGGCATGGGG - Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1079374868 11:19882835-19882857 CTGGGCAAGATGAAGGGATGAGG - Intronic
1080902538 11:36509883-36509905 CTGTGAAAAGCGAAGGGACAGGG + Intronic
1081214617 11:40380655-40380677 CAGTAAAAGAGGAAGGGTAGCGG - Intronic
1082234086 11:49801434-49801456 ATGGGGAAGAGGAAGGGAAGGGG - Intergenic
1082822396 11:57552900-57552922 CTGTGAAAGATGAAGAGCCAGGG - Intronic
1082964008 11:58947272-58947294 CTGGGAAACAGGATGGGACTGGG + Intronic
1083572478 11:63768143-63768165 GTCTGAAAGAGAAAGGGGCGGGG + Intronic
1083860342 11:65417018-65417040 CTGGGAAGGAGGAAGGGCCCAGG - Intergenic
1084022639 11:66426727-66426749 CTGTGTAAAAGGAAGGGTGGAGG + Intergenic
1084155460 11:67310499-67310521 CTGTGAAGGAGGCTGGGACCAGG - Intronic
1084187549 11:67482900-67482922 CTGTCAAGGAGGAAGGGCCGGGG - Intergenic
1084221794 11:67685819-67685841 CTGGGAAAGGGGAAGAGATGAGG + Intergenic
1084323934 11:68388328-68388350 CTGTGAAAAAGGAAGGGATGGGG + Intronic
1085271042 11:75269987-75270009 TTGGGAAAGAGGAAGGGACAGGG + Intronic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1086617505 11:88840010-88840032 ATGGGGAAGAGGAAGGGAAGGGG + Intronic
1087192428 11:95268990-95269012 TTGTGAAGGTGGAAGGGAAGTGG + Intergenic
1088544024 11:110941928-110941950 CTGAGGAGGAGGAAGGGAGGGGG + Intergenic
1088573958 11:111251723-111251745 ATGTGAAAGAGCAGGGGAGGGGG - Intergenic
1089224898 11:116910619-116910641 CTGGGAAAGAGAAAGGGACAAGG + Intronic
1089784594 11:120898904-120898926 CTGTGCAGGAGGAAGGGAAGGGG + Intronic
1090215050 11:124954373-124954395 CGGAGAAAGAGGGAGGGGCGGGG - Intronic
1090244602 11:125206966-125206988 CTGTGAGAGAGGGAGGGGCTGGG + Intronic
1091114900 11:133004045-133004067 CTGGGAAGGAGGAAGCGAAGAGG + Intronic
1091155523 11:133368167-133368189 ATGTGAAAGCGAAAGGGAGGGGG + Intronic
1091227306 11:133965231-133965253 CTGTGAAAGAGGCCGGGCAGCGG - Intergenic
1091585352 12:1812855-1812877 CTGTGAAACGGGAACGGATGTGG + Intronic
1093711840 12:22336192-22336214 CTGGAAAAGGGGAAGGGAAGGGG + Intronic
1095746114 12:45660745-45660767 CTGTGAAAGACAAAGGGAAGAGG - Intergenic
1096408539 12:51360936-51360958 CTGAGAAAGAGGAAAGGAGGGGG - Intronic
1096448973 12:51721510-51721532 CAGGGAAAGAGAGAGGGACGGGG - Intronic
1097988443 12:65808924-65808946 CTGAGAAAGAGGATGGAACTGGG - Intergenic
1098028395 12:66230121-66230143 CTGTGAAAAAGAACGGGACATGG - Intronic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1102760497 12:115380728-115380750 AAGTGAAAGAGGGAGGGAAGAGG + Intergenic
1103088096 12:118077497-118077519 CTGTGAAAGAGGAATGTTTGTGG + Intronic
1103841598 12:123869699-123869721 CTGAGAAGGAGGAAGGGGCTGGG - Intronic
1103988200 12:124780992-124781014 CTGGGAGAGAGGAAAGGAAGGGG + Intronic
1104224967 12:126822655-126822677 CTGAGGCAGAGGAAGGGAGGGGG + Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1107611259 13:42115513-42115535 CTTTGAAGGAGGATGGGATGGGG + Intronic
1109707007 13:66108653-66108675 ATGTGAATGAAGAAGGGAAGAGG - Intergenic
1110406012 13:75151354-75151376 CTGGTAAAGAGGGAGGGATGGGG + Intergenic
1110964823 13:81680128-81680150 CAGGAAAAGAGGAAGGGAGGTGG - Intergenic
1113661879 13:112113179-112113201 CTGTTAAAGAGGAAAGGTGGAGG + Intergenic
1113954646 13:114091186-114091208 CTGTGAAAGATGAAGGGTCTGGG + Intronic
1115151566 14:30292331-30292353 CTGGGAAAGAGGAAGAGAGAAGG + Intergenic
1115328222 14:32166005-32166027 CTGTGAAAGATAAAGAGAAGTGG - Intergenic
1115518487 14:34209088-34209110 CTGTTTAAGAGGAAAGGAGGAGG + Intronic
1115744440 14:36421422-36421444 CTGTGGAAAAGAAAGGGACAGGG - Intergenic
1116764194 14:49050771-49050793 CTTTGAGAGTGGAAGGGAGGAGG - Intergenic
1117357815 14:54942889-54942911 CTGCAAAAGAGGAAGAGACTTGG - Intronic
1118241299 14:64061046-64061068 CTCTGAAAGAGGCATGGAAGAGG - Intronic
1119217594 14:72880971-72880993 ATCTGAAAGAGGAAGTGAAGAGG - Intronic
1120183428 14:81368416-81368438 CTGTAAAAGAGGATGGGGCCAGG + Intronic
1120319809 14:82945124-82945146 CTGAGAAGGAGGAAGAGAAGGGG + Intergenic
1122853979 14:104551448-104551470 AGGTGAAAAAGGAAGGGAGGAGG - Intronic
1123469159 15:20537373-20537395 CAGTGAATGTGGAAGGGACAGGG + Intronic
1124103449 15:26716699-26716721 CTGTGAAAGAGAAAGGCAGTTGG - Intronic
1124286067 15:28401287-28401309 ATGTGAAAAAAGAAGGGAGGTGG - Intergenic
1124296634 15:28510373-28510395 ATGTGAAAAAAGAAGGGAGGTGG + Intergenic
1124329273 15:28795078-28795100 CAGTGAAGGAGGAAGAGACAAGG + Intergenic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1126341250 15:47643386-47643408 GTTTGAAAGAGGAAGGGGTGAGG + Intronic
1127613148 15:60656883-60656905 CTGTGATAGAGGAAAGCCCGTGG + Intronic
1128092361 15:64927499-64927521 CTGAGAAGGGGTAAGGGACGGGG + Intronic
1128342833 15:66834793-66834815 CTGTAAAAGTGGAGGGGGCGTGG - Intergenic
1129486775 15:75881279-75881301 CTCTCAAAGAGGAAGTGACAAGG - Intronic
1129628972 15:77236249-77236271 CTGTGAAAGCAGCTGGGACGGGG + Intronic
1129759904 15:78123303-78123325 CAGTGAAATAGCAAGGGACCTGG + Intronic
1129813726 15:78533136-78533158 CTATGAAAGAGAAATGGAAGGGG + Intronic
1130193338 15:81756876-81756898 CTGTGAAAGAAAATGGGACCGGG + Intergenic
1131197548 15:90367713-90367735 CAGGGAATGAGGAAGGGACAAGG - Intronic
1131348758 15:91677067-91677089 CTGTCAGAGATGAAGGGAGGAGG - Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1132681123 16:1142170-1142192 CTGAGGAAGAGGATGGGACGGGG - Intergenic
1135950966 16:26913769-26913791 CCGTGCAGCAGGAAGGGACGGGG - Intergenic
1136404496 16:30036215-30036237 CTTGGAAAAAGGAAGGGAGGGGG + Intronic
1137350121 16:47706094-47706116 TTGTCTAAGAGGAAGGGACTCGG + Intergenic
1138333197 16:56231599-56231621 CTGGGAAAGTGGGAGGGACGTGG + Intronic
1140139790 16:72244817-72244839 CTGTGAATCAAGAAGGGAAGTGG - Intergenic
1140236820 16:73166578-73166600 CTGGGAGAGAGGCAGGGAGGGGG + Intergenic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141140266 16:81492781-81492803 ATGTGGAAGAGGAGGGGAGGCGG + Intronic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141903134 16:87005937-87005959 CTGTTAAAGAGAGAGGGACCTGG + Intergenic
1143478197 17:7214741-7214763 CGGGGAAAGGGGGAGGGACGGGG + Intronic
1143595639 17:7912062-7912084 CTGGGAGGGAGGAAGGGACGAGG + Exonic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144630517 17:16869820-16869842 CTGTAAAGGAGAAAGGGGCGAGG - Intergenic
1144650804 17:17005635-17005657 CTGTAAAGGAGAAAGGGGCGAGG + Intergenic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1145816473 17:27798485-27798507 ATGTGAAGAAGGAAGGGACATGG - Intronic
1146497577 17:33336808-33336830 CTGTCAGAGAGGAGGGGGCGGGG + Intronic
1146937055 17:36818541-36818563 CTGTGAAGGAGGAAAGTAGGCGG - Intergenic
1147164918 17:38587924-38587946 GTGTGAAAGAGGAGGGGCAGGGG - Intronic
1147261182 17:39210495-39210517 CTGGGACAGAGGAAGGAAAGGGG - Intergenic
1147310326 17:39592263-39592285 CTGGGAAAGGGGATGGGATGGGG - Intergenic
1147575380 17:41595894-41595916 AAGGGAAAGAGGAAGGGAAGGGG + Intergenic
1147753994 17:42756093-42756115 GTGAGAAAGAGGCAGGGTCGGGG - Intergenic
1148061977 17:44842920-44842942 GTGTTAAAGGGGAAGGGATGGGG - Intergenic
1148150920 17:45396118-45396140 CTGTGGCGGAGGAAGGGAGGAGG + Intronic
1148465173 17:47860814-47860836 GGGTGAAAGAGGAAGGGTCAGGG - Intergenic
1148738621 17:49879592-49879614 GTGGGAGAGAGGAAGGGAGGGGG - Intergenic
1148749152 17:49934852-49934874 CTGTGAAGGAGGTATGGAGGAGG - Intergenic
1150756133 17:67915760-67915782 CTGTAAGAGAGGAAAGGACAAGG - Intronic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1151906152 17:77050687-77050709 CTGGCAAAGTGGAAGGGCCGGGG - Intergenic
1152007562 17:77691993-77692015 CTGTGACGGGGGTAGGGACGGGG - Intergenic
1152236537 17:79141966-79141988 CTGAGAAAGAGGAGGAGACGGGG + Intronic
1152354330 17:79799334-79799356 CTGTGGAAGTGGGAGGGAGGGGG + Intronic
1152849955 17:82627672-82627694 CACTGAGAGAGGAACGGACGGGG - Intronic
1152855532 17:82663164-82663186 CTGTGCAGCAGGAAGGGTCGGGG + Intronic
1152997888 18:425307-425329 CTGGAAAAGAGCAAGGGTCGGGG - Intronic
1153833681 18:8945255-8945277 CTGAGGGAGAGGAAGGGACCAGG + Intergenic
1154506532 18:15045861-15045883 CTGTGATAGAGACAGGGAAGGGG - Intergenic
1155298431 18:24406883-24406905 CTCTGAAGGAGGGAGGGACAGGG - Intergenic
1155789362 18:29946172-29946194 AGGGGAAAGAGGAAGGGAAGGGG + Intergenic
1155987391 18:32244754-32244776 CTGTCTAAAAGGAAGGGACAGGG - Intronic
1157623613 18:49030398-49030420 CTGTGAATGATGAGGTGACGGGG - Intergenic
1159092163 18:63861400-63861422 CACTGAAAGTGGAAGGGAAGAGG - Intergenic
1160531327 18:79566582-79566604 CTGTAGATGAGAAAGGGACGGGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162602053 19:11676858-11676880 CTGTCCAGGAGGAAGGGAGGTGG - Intergenic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1163739229 19:19000390-19000412 CAGTGAAAGAGAAATGGATGAGG - Intronic
1164529355 19:29036458-29036480 CTGTGAAAGATAGAGGGAAGAGG + Intergenic
1164610419 19:29627943-29627965 CTGTGACAGAGGGAGGGCTGGGG - Intergenic
1164988057 19:32663401-32663423 CTTTGAAATTGGAAAGGACGTGG - Intronic
1165448141 19:35868129-35868151 ATCTGAAAGAGGAAGGGACTAGG + Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165956274 19:39503778-39503800 CTTGGAAAGAGGATGGGACAGGG - Intronic
1166273306 19:41732472-41732494 AAGTGAAAGAGGAAGGCAGGAGG - Intronic
1166278376 19:41772297-41772319 AAGTGAAAGAGGAAGGCAGGAGG - Intergenic
1166489949 19:43250091-43250113 GAGTGAAAGAGGAAGGCAGGAGG + Intronic
1167374673 19:49104344-49104366 ATGTGGGAGAGGAAGGGCCGGGG + Intronic
1168110385 19:54188900-54188922 CTGTCGAAGAGGAAGGGTCCGGG - Intronic
1168309108 19:55451883-55451905 CTGGGACAGAGAAAGAGACGTGG - Intergenic
925467765 2:4124677-4124699 GTGTGTAAGAGAAATGGACGAGG + Intergenic
926268670 2:11347848-11347870 CTGGGAAAGGTGAAGGGACATGG - Intronic
926388059 2:12357974-12357996 ATGTGAAAGAAGGAGGGATGGGG + Intergenic
926464726 2:13174366-13174388 GTGGGAAAGAGGAAGGAATGAGG - Intergenic
926695910 2:15770199-15770221 CTCTGAAAGAGAAATGGAAGGGG - Intergenic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927666035 2:25033462-25033484 CTGGGAAACAGGAAGAGACTTGG + Intergenic
928211808 2:29329086-29329108 CTTTGATAGAGGATGGGACAGGG - Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
928878802 2:36073208-36073230 GAGAGAAAGAGAAAGGGACGTGG - Intergenic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
931117862 2:59184144-59184166 ATATGAAAAAGGAAGGGAGGTGG + Intergenic
931129796 2:59322289-59322311 CTGTGAAAGAGGATGGGCCAGGG - Intergenic
931271326 2:60705940-60705962 TTGAGAAGGAGGAAGGGAAGAGG - Intergenic
931799232 2:65742273-65742295 AAGTGAGAGAGGAAGGGAGGAGG + Intergenic
931933982 2:67175215-67175237 TTATGAAAGCGGAAGGGAAGGGG - Intergenic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
932606796 2:73170654-73170676 GTGTGACAGAGGAAGGGAGGGGG + Intergenic
933643153 2:84785912-84785934 CTGTGAAATACGAAGGCAAGGGG - Intronic
933925632 2:87089756-87089778 GTGTGACAGAGGAAGGGAGGGGG - Intergenic
934039372 2:88115358-88115380 CAGTAAAAGAGGAAGGCAGGAGG - Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
934665203 2:96164721-96164743 CCGGGAAGGAGGAAGGGAAGGGG - Intergenic
936082771 2:109446242-109446264 CTGTGAAATCGGAAGTGACATGG + Intronic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937951862 2:127394436-127394458 CAGTGTGGGAGGAAGGGACGAGG - Intergenic
938225188 2:129609732-129609754 TTGAAAAAGAGGAAGGGATGGGG + Intergenic
939506133 2:143049601-143049623 CTGTAACAGAGGAAGTGAAGGGG - Exonic
940994188 2:160129132-160129154 CTGTTAAAGAGGGAGGCACCTGG + Intronic
941158601 2:162009000-162009022 GAGTGAAAGAGGGAGGGAAGAGG - Intronic
941159189 2:162016540-162016562 CTGTCAAAAAGGAAGGGATTTGG - Intronic
941743955 2:169066524-169066546 CTGTCACAGAGGGAGGGAGGTGG - Exonic
944663582 2:201940772-201940794 CTGTGAAAGATGAAAGGGCAAGG - Intergenic
946508371 2:220326157-220326179 GTGAGAAAGAAGAAGGGAAGAGG - Intergenic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
948066807 2:235087264-235087286 CTGTGAAGGTGGAAGCCACGGGG - Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
948753513 2:240145638-240145660 CTGGGAATGAGGAGGGGACGTGG + Intergenic
948934158 2:241151342-241151364 ATGTGAAAGGGGTAGGGAAGAGG + Intronic
1168935508 20:1661888-1661910 CTGTCAATGAGGAAGGGTCATGG - Intergenic
1170848808 20:19985011-19985033 CAGTGAGAGGGGAAGGGACTTGG + Intronic
1173506535 20:43591280-43591302 CTATGAAAGAGCATGGGACGAGG + Intronic
1173559533 20:43993052-43993074 CGCTGAATGAGGAAGGCACGTGG + Intronic
1174063530 20:47848748-47848770 CAGAGGAAGAGGAAGGGACGTGG - Intergenic
1174151876 20:48491765-48491787 CAGAGGGAGAGGAAGGGACGTGG - Intergenic
1174315930 20:49701577-49701599 TTGTGGACGAGGAAGGCACGGGG + Intronic
1176340984 21:5695829-5695851 CTGGGAAAGAAGAAGGGATGTGG - Intergenic
1176473238 21:7127982-7128004 CTGGGAAAGAAGAAGGGATGTGG - Intergenic
1176503843 21:7628627-7628649 CTGGGAAAGAAGAAGGGATGTGG + Intergenic
1176791332 21:13323246-13323268 CTGTGATAGAGACAGGGAAGGGG + Intergenic
1177990463 21:28030126-28030148 CTGTGATAGAGACAGGGAAGGGG - Intergenic
1178431817 21:32524307-32524329 CTGGGAAAGATTAAGGGAAGAGG + Intergenic
1178923939 21:36759944-36759966 CTGAAAAAGAGGAGAGGACGAGG - Intronic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1179410593 21:41159965-41159987 CAGTGAAGGAGGGAGGGAAGGGG - Intergenic
1179492480 21:41750339-41750361 ATTTGAAAAAGGAAGGGACTAGG + Intronic
1180246887 21:46554482-46554504 CTGCGAGAGAGGAGGGGAGGTGG - Intronic
1181583059 22:23838491-23838513 CTGGGAGAGAGGCCGGGACGGGG - Intronic
1181725073 22:24806008-24806030 CTAGGGAAGAGGGAGGGACGCGG + Intergenic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1185289791 22:50017532-50017554 AAGTGAAGGAGGAGGGGACGTGG + Intronic
1203240250 22_KI270733v1_random:10287-10309 CTGGGAAAGAAGAAGGGATGTGG - Intergenic
949852735 3:8435116-8435138 CTGTGAAAGAAGAAAGGAAAGGG + Intergenic
951359700 3:21710950-21710972 CTATGATAGAGGAAGGAATGGGG - Intronic
951398594 3:22202630-22202652 CTTTGAAAGAGGAACTGAAGAGG + Intronic
952817269 3:37456527-37456549 CAGAGAAGGAGGAGGGGACGGGG - Intronic
954573704 3:51663069-51663091 CCGTGGAAGAGGAACTGACGGGG - Exonic
955618686 3:60837198-60837220 TGGTGAAAAAGGGAGGGACGTGG + Intronic
956108961 3:65851932-65851954 CTGCGAAAGAGGCAAGAACGGGG + Intronic
956783423 3:72622846-72622868 CAGTGAAAGAGAAAGGAAAGGGG - Intergenic
956849967 3:73219976-73219998 CTGGGTAAGAGGAAGGGCTGAGG + Intergenic
956990413 3:74756680-74756702 CTGTGAAAGATGAGGGGGCGAGG - Intergenic
957457698 3:80473134-80473156 CTGTGAAAGAAGCTGGGAGGAGG + Intergenic
961744281 3:129053874-129053896 CTTTGAAAGAGGAGGGGTTGGGG + Intergenic
962924644 3:139980370-139980392 AAGTGAAAGAGCAAGGGACATGG - Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
963530938 3:146472562-146472584 CTCACAAAGTGGAAGGGACGAGG + Intronic
963863931 3:150340250-150340272 CTGTGAAGGATAAAGGGAGGAGG + Intergenic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
964959237 3:162403727-162403749 CTTTGGAAGAGGAAGGGTCCAGG + Intergenic
965086212 3:164101809-164101831 CAGTGAAGGAGGAAAGGATGGGG - Intergenic
966248146 3:177831644-177831666 ATCTGAAGGAGGAAGGGAGGTGG - Intergenic
967094690 3:186167490-186167512 CTGTGATAGAGGAAGTAAAGGGG - Intronic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968783253 4:2599252-2599274 CTTTGACAGAGGAAGGAAAGTGG - Intronic
969519122 4:7665600-7665622 CTGTGATGGAGGAAGGCACAGGG - Intronic
969528401 4:7715855-7715877 CTGTGACAGAGGCAGGCTCGGGG - Intronic
969538899 4:7773707-7773729 CTGTGCCAGAGAATGGGACGGGG - Intronic
970023658 4:11597031-11597053 GTCTGAAAGAGGAAGGGAGGGGG - Intergenic
970373908 4:15436757-15436779 CTCTAAAAGAGGAAGGGATTTGG + Intronic
970506350 4:16734597-16734619 CTGGGGCAGAGGAAGGGAAGAGG - Intronic
970573983 4:17409588-17409610 CTGAGGAATAGGAAGGGACATGG + Intergenic
971019082 4:22516134-22516156 CCGGGAAAGAGGAGGGGAAGGGG - Intergenic
972271217 4:37512148-37512170 CTCTGAAAGAGGCAGTGAAGAGG - Intronic
973690092 4:53419317-53419339 CTGTTGAAGAAGAAGGGAAGGGG + Intronic
974925403 4:68292082-68292104 CTGTGAAAGCAGCAGGGAAGGGG - Intergenic
975732821 4:77354238-77354260 CTGTTACACAGAAAGGGACGGGG - Intronic
976937532 4:90656056-90656078 CTCTGAAAGATGAAGTGAAGAGG - Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
977822102 4:101485164-101485186 ATGAGAAAGAGGAAGGGAAAAGG + Intronic
977983804 4:103359022-103359044 CTTTGAGACAGGAAGGGAAGAGG + Intergenic
978403954 4:108360536-108360558 CTCTGAACAAGGAAGGGAAGAGG - Intergenic
979446979 4:120825474-120825496 GTGTGAGAGAGGAAGGGTCAAGG - Intronic
979447104 4:120826826-120826848 GTGTGAGAGAGGAAGGGTCAAGG + Intronic
981532021 4:145762320-145762342 CTGCTAATGAGGAAGGGAGGAGG + Intronic
981562604 4:146063982-146064004 CTGTGAAAGGTAAAGGGATGAGG - Intergenic
982335377 4:154231280-154231302 AAGTGAAAGAGGAAGGGAGGGGG - Intergenic
982376069 4:154692321-154692343 CTGTGAAATCTGAAGGGAGGTGG - Intronic
982633543 4:157863965-157863987 CTTGGAAAGAGGAAAGGAGGTGG + Intergenic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
984911452 4:184676961-184676983 GGGGGAAAGAGGAAGGGAAGGGG - Intronic
985726261 5:1517329-1517351 CTGTGTCAGAGGCAGGGACATGG + Intronic
985777236 5:1851258-1851280 GGGTGAAAGACGAACGGACGGGG - Intergenic
985777820 5:1854105-1854127 CTGTGGTAGAGGCAGGGAAGAGG - Intergenic
987092542 5:14521210-14521232 CACTGAAAGAGGAAGGGAGTTGG - Intronic
988057585 5:26119680-26119702 CTGTGAATGAGGAAGACACGGGG + Intergenic
989797213 5:45490465-45490487 CTCAGAAAGAGGAAGGGACAAGG - Intronic
990299236 5:54434112-54434134 CTGTGAAAGAGAAGAGGAAGAGG + Intergenic
991979435 5:72215955-72215977 CTGTGAAAAATGAAAGGAGGTGG - Intergenic
992129569 5:73678099-73678121 CTGTGAAAGAGGAATTAACTTGG + Intronic
992689861 5:79231683-79231705 CTGTGGAAGAGAAGGGGAAGGGG - Intronic
996549798 5:124718096-124718118 CTTTGAAAGAAGAAGAGAAGAGG - Intronic
997013476 5:129904929-129904951 CTGAGCGAGAGGAAGAGACGTGG + Exonic
998294198 5:140951525-140951547 CGGTGCAGGAGCAAGGGACGGGG + Intronic
1000312837 5:160061889-160061911 CTGTGGAGGAGGAAAGGCCGGGG + Intronic
1000596420 5:163219748-163219770 CTGTGAAAGAGGAAGCTGCTGGG + Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1002789132 6:424849-424871 CTGGGACAGAGGAAGGGGCCAGG + Intergenic
1003254180 6:4459900-4459922 CTGGGAAACAGGAAGAGTCGGGG + Intergenic
1003682351 6:8268626-8268648 CAGTGACAGAGGAAGGGCAGAGG + Intergenic
1004012366 6:11702101-11702123 CTGTGAAGGATGAAGGGTTGAGG - Intergenic
1005438444 6:25839330-25839352 CTGCTAAAGTGGAAGGGACAAGG - Intronic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006043929 6:31277578-31277600 CTATTAAAGAGGAAGAGAAGAGG + Intronic
1006817688 6:36863987-36864009 CTGTGAAAGATAAAGGGTCAGGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007521167 6:42452553-42452575 CTCTGGACGAGGATGGGACGGGG + Intergenic
1008801300 6:55371884-55371906 CTGTGAAAGGGGAAAAGACATGG - Intronic
1010515712 6:76770675-76770697 CTGTAGAAGAGGAAAGGACTAGG - Intergenic
1012551543 6:100468003-100468025 CTGTGCCAGAGCAAGGGTCGGGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013163853 6:107571929-107571951 CTGTGACAAGGCAAGGGACGAGG + Intronic
1014281903 6:119450821-119450843 TGGTGCAAGAGGCAGGGACGTGG - Intergenic
1014769212 6:125442277-125442299 GTGTGAAAGAGAGAGGGAGGAGG - Intergenic
1015881371 6:137873330-137873352 CGGTGAATGAGGAAGGGAGTAGG + Intronic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017625305 6:156341667-156341689 GGGAGAAAGAGGGAGGGACGGGG - Intergenic
1018037553 6:159894180-159894202 CTGTGGAGTAGGAAGGGAAGAGG + Intergenic
1018200874 6:161394356-161394378 TTGTGAAAGACAAAGGAACGTGG - Intronic
1019258152 7:64726-64748 CTGAGCAAGAAGAAGGGAGGGGG - Intergenic
1019657410 7:2203238-2203260 CTATGAAATAGGAAGGGAGTGGG - Intronic
1019686059 7:2382894-2382916 CTGGGAAAGGGGAGGAGACGTGG + Intergenic
1020592528 7:10159246-10159268 CTGTGGAAGAAGAAGGGCAGGGG + Intergenic
1020828268 7:13059467-13059489 GTCTGAAAGATGAAGGGAAGAGG - Intergenic
1021163395 7:17303563-17303585 GTTTTAAAGAGGAAGGGAGGTGG - Intronic
1022106423 7:27200415-27200437 CTGGGATAAAGGAAGGGAAGGGG - Intergenic
1023200349 7:37690419-37690441 CTGTGAAAGGGGAAAGGACAGGG - Intronic
1023259314 7:38342288-38342310 CTGGGAATGAGAAAGGGAAGGGG + Intergenic
1023259773 7:38346609-38346631 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023260248 7:38350938-38350960 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023261225 7:38360089-38360111 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023261741 7:38364901-38364923 CTGGGAATGAGAAAGGGAGGGGG + Intergenic
1023352720 7:39336304-39336326 CTCTGAAGGTGGAAGGGATGGGG - Intronic
1023840236 7:44093006-44093028 CTGTGAGAGAGAAAGAGGCGAGG + Intergenic
1023990945 7:45127871-45127893 CTGTCAAGGAAGAAGGGACTAGG - Intergenic
1024201984 7:47117267-47117289 CTGGGAGAGAGGAAGGGCCCAGG - Intergenic
1024228215 7:47344589-47344611 CTGGGAAAGATGTAGGGATGTGG - Intronic
1024544237 7:50503439-50503461 CTCTGAATGAGGAAGGGAGGAGG + Intronic
1025706320 7:63867897-63867919 CTGGGAAAGAAGAAGGGACGTGG + Intergenic
1025941103 7:66076607-66076629 CAGTGAGACAGGAAGGGACCAGG - Intronic
1026068156 7:67093995-67094017 CTCCAAAAGAGGATGGGACGGGG - Intronic
1026708764 7:72718313-72718335 CTCCAAAAGAGGATGGGACGGGG + Intronic
1027461976 7:78465804-78465826 TTCTGAAAGAGGAAGGGATTTGG - Intronic
1027506415 7:79021377-79021399 CTGTGAAAGCGGCTGGGAGGGGG + Intronic
1028242397 7:88437260-88437282 AAGTGAAAGAGGATGGGACTTGG - Intergenic
1028492035 7:91423368-91423390 CTGTGGAAGATGAAGAGAGGGGG - Intergenic
1028595183 7:92540776-92540798 CTGTTAAGGAGGAAGGCACTGGG + Intergenic
1028796166 7:94907281-94907303 CTGCCAAAGAGAAAGGGATGAGG - Intronic
1029733764 7:102454387-102454409 CTGTGAAAGGGGTTGAGACGTGG - Exonic
1029831678 7:103267035-103267057 CAGTGGGAGAGGAAGGGATGAGG - Intergenic
1029925241 7:104308880-104308902 GGGTGAGAGAGGAAGCGACGGGG - Intergenic
1031560345 7:123230774-123230796 CTGTGCAAGTGGAGGGGGCGTGG + Intergenic
1033209031 7:139446680-139446702 CTTTGAAGGAGGAGGGGACCAGG - Intergenic
1033370673 7:140704589-140704611 CTGTGATAGAGGGAGGGTAGGGG - Intronic
1034933817 7:155185335-155185357 GTGTGAAGGAAGAAGGGACTGGG - Intergenic
1035676950 8:1462693-1462715 CTGGGGAAGGGGAAGGGACCAGG + Intergenic
1035709504 8:1701428-1701450 CCGGGAAAGCGGAAGCGACGAGG - Exonic
1036475612 8:9090229-9090251 CTGTGAGAGAGGAAAGGAAGAGG + Intronic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1038180454 8:25222499-25222521 CTGTGAAACAGCTAGAGACGGGG - Intronic
1038417158 8:27405379-27405401 CAGTGCAAGAGGTAGGGAGGAGG + Intronic
1039621415 8:39000280-39000302 CTGTGAGAGAGGCTGGGGCGCGG - Intronic
1040821488 8:51563365-51563387 CCTTGAAAGAGGAAGAGACATGG - Intronic
1041115355 8:54530481-54530503 CTGAGAAAGAGCAAGAGAGGAGG - Intergenic
1041173628 8:55170914-55170936 ATGTTAAAGAAGAAGGGAGGGGG - Intronic
1041181845 8:55257416-55257438 TTCAGAGAGAGGAAGGGACGAGG + Intronic
1041601172 8:59718785-59718807 CAGAGAAGGAGGAAGGGAAGGGG + Intergenic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1042905308 8:73766359-73766381 CTGGGAAAAAGGCAGGGACCAGG + Intronic
1046398352 8:113671253-113671275 CTTTGAAAGATGAAGGAAGGAGG - Intergenic
1046861316 8:119094704-119094726 CTGTCAAAGAGGAATGGCCCAGG + Intronic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048539804 8:135332619-135332641 CTGCTAAAGAGGAAGGGTCCAGG - Intergenic
1049286086 8:141776090-141776112 CTCTCAAAGACGAAGGGTCGTGG + Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1050853758 9:10323302-10323324 CTGAAAAAGAGGAAGGGAATGGG - Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053527261 9:38842727-38842749 CCATGAAAGAGAAAGGGACAAGG + Intergenic
1053777870 9:41567251-41567273 CTATGAGAGAGGAAGGGATGGGG - Intergenic
1054199484 9:62067158-62067180 CCATGAAAGAGAAAGGGACAAGG + Intergenic
1054638871 9:67521199-67521221 CCATGAAAGAGAAAGGGACAAGG - Intergenic
1056662187 9:88552192-88552214 CTGTAAAAGCGGAAGGGGAGTGG - Intronic
1057291458 9:93809896-93809918 CTGGGAGAGAGGGAGGGAGGGGG + Intergenic
1058177996 9:101760493-101760515 GTGGGAAAGAGGGAGGGATGGGG + Intergenic
1059003163 9:110372326-110372348 CTAGGAAAGGGGAAGGGATGTGG - Intronic
1059542385 9:115143981-115144003 GAGGGAAAGAGGAAGGGAAGGGG - Intronic
1059767889 9:117400970-117400992 CTGCAAAAGAGGTAGGGAGGGGG + Intronic
1060163006 9:121383950-121383972 ATCAGAAAGAGGAAGGGACAAGG + Intergenic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1061045517 9:128162967-128162989 GTGTGAGAGAGGAAAGGAAGAGG + Intronic
1061403006 9:130378506-130378528 CTGGGAAAGAGGCTGGGAGGGGG + Intronic
1061428374 9:130515556-130515578 CCATGAAAGAGGAAGGAACCAGG - Intergenic
1061619418 9:131801848-131801870 CTGGGAAAGATGTAGGGAAGAGG - Intergenic
1061929430 9:133824825-133824847 CTCTGAGAGAGGAAGGCACCTGG - Intronic
1062318539 9:135979520-135979542 GTGGGAGAGAGGAGGGGACGGGG - Intergenic
1203422083 Un_GL000195v1:2164-2186 CTGGGAAAGAAGAAGGGATGTGG + Intergenic
1185745743 X:2572120-2572142 CTGTGAAAGGTGGAGGGACTGGG - Intergenic
1186397566 X:9225187-9225209 CTGTGAAGGAGAAAGGCATGGGG - Intergenic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1187007019 X:15241981-15242003 CAATGAAAGAGGAAGGCAAGAGG - Intronic
1187055606 X:15738737-15738759 CTGTGAAATAGCTAGAGACGGGG + Intronic
1187452674 X:19412588-19412610 AAGAGAAAGAGGAAGGGAGGGGG + Intronic
1188533901 X:31173577-31173599 GTGTGAAAGCTGAGGGGACGAGG + Exonic
1189128972 X:38478967-38478989 CTGAGAAAGGTGAAGGGACTGGG + Intronic
1189301431 X:39955318-39955340 CTGTGATACAGGAAGAAACGAGG + Intergenic
1189765802 X:44370763-44370785 TTGTGAAAAAGAAAGTGACGTGG - Intergenic
1190440320 X:50469891-50469913 CTGAGAAAGATGCAGGGATGGGG - Intronic
1190598458 X:52067898-52067920 CTGTGAATGGGGGAGGGAGGAGG - Intronic
1190610366 X:52186175-52186197 CTGTGAATGGGGGAGGGAGGAGG + Intronic
1192797457 X:74435880-74435902 TTGAGAAAGGGGAAGGGACTTGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196661365 X:118273649-118273671 CATTGAAAGAGGAAGGGATTAGG + Intergenic
1197263613 X:124342804-124342826 CTGAGATAGAGGAAAGGATGGGG - Intronic
1197868627 X:131044888-131044910 CAGTGAAAGAAAAAGGGATGAGG - Intergenic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1201017760 Y:9623407-9623429 CTGTGGGACAGGAAGGGGCGGGG - Intergenic