ID: 1181803147

View in Genome Browser
Species Human (GRCh38)
Location 22:25360129-25360151
Sequence GTCCAGCTGCAGCACGATGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181803141_1181803147 21 Left 1181803141 22:25360085-25360107 CCCTCCATTGGGTCATAGTTGAT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG 0: 1
1: 1
2: 0
3: 13
4: 141
1181803144_1181803147 17 Left 1181803144 22:25360089-25360111 CCATTGGGTCATAGTTGATGGCG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG 0: 1
1: 1
2: 0
3: 13
4: 141
1181803142_1181803147 20 Left 1181803142 22:25360086-25360108 CCTCCATTGGGTCATAGTTGATG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG 0: 1
1: 1
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181803147 Original CRISPR GTCCAGCTGCAGCACGATGT CGG Exonic
901768915 1:11520777-11520799 GTCCAGCAGCACCTGGATGTTGG - Exonic
903167281 1:21529585-21529607 ATCCAGCTGCTGAACGATGGAGG - Intronic
907553626 1:55325796-55325818 TTCCAGATGCAGCAGGGTGTAGG - Intergenic
912240610 1:107903961-107903983 ATCCAGCTGCAGATCGATGAGGG - Intronic
912400711 1:109389447-109389469 TTCCAAATGCAGCACCATGTTGG + Intronic
912673032 1:111649115-111649137 GTCAATCTGCAGAACGATGTGGG + Intronic
915099685 1:153490302-153490324 GTCCAGCTCCAGGACCAGGTAGG - Intergenic
919230057 1:194762700-194762722 GTCCAGCTGCTTCAGGATGATGG + Intergenic
1064011989 10:11742716-11742738 GTCCAGCTGCCGCGCGCTGGTGG - Exonic
1071032920 10:81206053-81206075 ATCCAGCTGCTCCAGGATGTTGG - Intergenic
1072728413 10:97828856-97828878 TTCCTGCTGCACCAGGATGTGGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1072941626 10:99769513-99769535 GTCCAGATTCAGGACAATGTGGG - Intergenic
1075464852 10:122643497-122643519 GACCAGGTGCAGCACAATGTAGG - Exonic
1075542540 10:123327593-123327615 GTCCAGCTGCAGCCAGTTATAGG + Intergenic
1077104754 11:837337-837359 GACCAGCTGCAGCAGGAGGTGGG + Exonic
1080827580 11:35861071-35861093 GTCGATCTGCAGAATGATGTGGG + Intergenic
1083732707 11:64661364-64661386 GCCCAGCTGCAGAATGCTGTGGG + Intronic
1084323522 11:68386388-68386410 GTCCACCTGCAGCACGATGTCGG - Exonic
1084330288 11:68426005-68426027 GCCCAGAGGCTGCACGATGTTGG - Exonic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1093763841 12:22939989-22940011 GTGCAGCAGCAGCACAATCTTGG + Intergenic
1096634638 12:52950353-52950375 GTCAATCTGCAGAACGATGCGGG - Exonic
1099316861 12:81094923-81094945 GAGCAGCAGCAGCACGATGCAGG - Intronic
1101468998 12:104977564-104977586 GTCGATCTGCAGAACGATGCAGG + Intergenic
1103566833 12:121820288-121820310 GTGCAGCAGCATCACGATGCCGG - Intronic
1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG + Intronic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1105420322 13:20246579-20246601 GCCCCGCTGCAGAAGGATGTGGG + Intergenic
1111581673 13:90230833-90230855 GTCTATCTGCAGAACGATGTGGG - Intergenic
1113834469 13:113319607-113319629 GTTCAGCTGCAGCCCCATGCTGG - Exonic
1114674407 14:24430879-24430901 CTCCAGCTGCAGCCAGATGTGGG - Exonic
1115662694 14:35512622-35512644 GTCAATCTGCAGAACGATGCAGG + Intergenic
1117942252 14:60980982-60981004 ATCCAGCTGCAGAGCGACGTGGG - Exonic
1118966841 14:70595001-70595023 GTCGATCTGCAGAACAATGTGGG - Intronic
1119124549 14:72113467-72113489 CTCCAGTTGAAGCAGGATGTAGG - Intronic
1121637892 14:95466123-95466145 GCCCAGCTGGAGCTCGATGTGGG + Exonic
1121867192 14:97373500-97373522 GTCCAGCTGAAGCAAGCTGAGGG + Intergenic
1127849656 15:62901647-62901669 GTTCCGCTGCAGCATGAGGTGGG + Intergenic
1133211424 16:4265191-4265213 GTCCAGCTGCAGCAAGCGCTGGG + Intronic
1136871563 16:33812331-33812353 GGTCAGCTGGAGCACGAGGTGGG - Intergenic
1138224456 16:55280874-55280896 GTCCAGCTGCAGCACACCCTGGG - Intergenic
1138781750 16:59796796-59796818 GTCCAGCTACAGAACTATGAGGG + Intergenic
1140181953 16:72729057-72729079 GTCAATCTGCAGAACGATGCAGG - Intergenic
1140514224 16:75530546-75530568 GTCCAGTTGCAGAATAATGTGGG + Exonic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1203100609 16_KI270728v1_random:1303727-1303749 GGTCAGCTGGAGCACGAGGTGGG + Intergenic
1142506115 17:364341-364363 GTCCTGCTTCAGCTCCATGTTGG - Intronic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1145871439 17:28276879-28276901 GTCGATCTGCAGAACAATGTGGG + Intergenic
1145889535 17:28405272-28405294 GTGCAGCTGCAGCTCCACGTCGG - Exonic
1145985733 17:29044970-29044992 GCCCAGCTGGAGCACGAGGCTGG + Exonic
1146163052 17:30570216-30570238 GTCAATCTGTAGCAGGATGTTGG + Intergenic
1147486596 17:40821070-40821092 GTCGATCTGAAGCAGGATGTTGG + Exonic
1147580038 17:41622985-41623007 GTCAATCTGTAGCAGGATGTTGG + Exonic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1150498367 17:65626476-65626498 GTCCAGCTACAGCATGAAATGGG - Intronic
1151698620 17:75730930-75730952 CTCCAGCAGCTCCACGATGTTGG - Exonic
1151787417 17:76281826-76281848 GTCCAGTTGCAGCAGGAGGGAGG + Intronic
1153907873 18:9679072-9679094 GTCAATCTGCAGCACGATGCAGG + Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1158945309 18:62442525-62442547 GTCCAGATGCAGGATGGTGTGGG - Intergenic
1160356438 18:78231133-78231155 TTCTAACTGCAGCAGGATGTGGG - Intergenic
1162341878 19:10096208-10096230 GCGCAGCTGCAGCACGAGGCGGG - Exonic
1162432318 19:10636459-10636481 GCCCAGCGCCAGCACGAAGTTGG - Exonic
1163132813 19:15286273-15286295 GTCTTGCTGCAGCACTGTGTTGG - Intronic
1163459418 19:17427649-17427671 TTCCAACTGCAGCAGAATGTGGG - Intronic
1163986841 19:20961527-20961549 GTCGATCTGCAGAACGATGTGGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1168113558 19:54208543-54208565 GGCCAGCTGCTGCACCATCTGGG + Intronic
924962073 2:44970-44992 GTCCACCTGCAGCCCTAGGTAGG - Intronic
926784473 2:16506978-16507000 TTCCAGCTGCATCACGTTCTAGG - Intergenic
927685056 2:25164747-25164769 GAGCGGCTGCAGCACGATCTCGG + Exonic
929850001 2:45578016-45578038 TTCCAGCAGCATCACCATGTAGG + Intronic
931213464 2:60219676-60219698 GGTCAGAAGCAGCACGATGTTGG + Intergenic
932506138 2:72233761-72233783 GTCCTGCTTCAGCACGACTTTGG + Intronic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
935157888 2:100499732-100499754 TTCCAGCTGCAGCATGACCTTGG + Intergenic
935898996 2:107770515-107770537 GTCCAGCTGTAGCACCCAGTGGG + Intergenic
936581768 2:113706316-113706338 CTCCAGCTGCAGCACCCTGAAGG + Intronic
937019402 2:118636417-118636439 ATGCAGCTGCAGCAAGCTGTGGG + Intergenic
939577537 2:143914521-143914543 TTCCAGCTGCAGAACGATAAAGG + Intergenic
945725667 2:213470231-213470253 GTCCAGCTGCTTCAGGATGATGG + Intronic
946154340 2:217797350-217797372 GGCCAGCTGCAGAGGGATGTAGG - Intergenic
1169475547 20:5928207-5928229 GTCCACCTGCAGGACAATGATGG - Intergenic
1169488156 20:6050862-6050884 GTCCAGCTGCTGCAGGTTGGGGG + Exonic
1170385518 20:15811937-15811959 GTCAAGCTGCAGTAAGAAGTGGG + Intronic
1170695060 20:18650494-18650516 GGGCAGCTGCAGCATGAAGTAGG - Intronic
1171140096 20:22733625-22733647 GTCAATCTGCAGAACGATGTGGG + Intergenic
1171232977 20:23501978-23502000 GTCAAGCTACAGCATGGTGTAGG - Intergenic
1171454033 20:25256788-25256810 GTCCTGCAGCAGCAGGATTTGGG + Intronic
1175709507 20:61207936-61207958 GTCCAGCTGCTTCACCATGAGGG - Intergenic
1177387393 21:20425776-20425798 GTCGATCTGCAGAACGATGCAGG + Intergenic
1178622429 21:34188237-34188259 GTCCTGCTGCAGCACGTGGGCGG - Intergenic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1182650330 22:31846501-31846523 TTCCAGCTCCAGTAGGATGTGGG + Intronic
1184970721 22:48018034-48018056 GTCAACCTGCAGCCTGATGTGGG + Intergenic
951170543 3:19536915-19536937 GTCCAGCTGCAGCTCCATGCAGG - Intergenic
952344111 3:32468200-32468222 GTCCAGTGGCGGCACGATCTCGG + Intronic
954144952 3:48629931-48629953 GTCCAGGTTCAGCAAGATGGTGG + Exonic
959809063 3:110594067-110594089 GTCAAGCTGATGCAAGATGTGGG - Intergenic
960362611 3:116732761-116732783 GTCCAGCTTGAGCATGATGAAGG + Intronic
961263032 3:125617662-125617684 ATCCAGCTGCTTCAGGATGTTGG - Intergenic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
963331626 3:143922104-143922126 ATCCAGCTGCTGCAGGATGATGG + Intergenic
964119062 3:153163166-153163188 GTTCATCTGCCGCACGATCTCGG - Exonic
964697305 3:159524169-159524191 GTCCAGCTGCCACATGAGGTGGG + Intronic
968397502 4:256531-256553 GTCCAGCTGCTGCACCATCTGGG - Intergenic
971884913 4:32432117-32432139 TGTCAGCTGCAGCAGGATGTAGG - Intergenic
975003430 4:69255752-69255774 GTGCAGCAGCAGCACCATCTTGG - Intergenic
975290618 4:72673947-72673969 GTCCAGCTGCTTCAGGATGATGG + Intergenic
981563855 4:146077041-146077063 GTACTGCTGCAGCACCTTGTTGG + Intergenic
982452201 4:155566473-155566495 GTCCAGCTGCAGTACAATACTGG - Intergenic
984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG + Intergenic
985523356 5:389476-389498 GTCCAGCTGCATCACGCATTGGG - Intronic
986403183 5:7398738-7398760 GACCAGCTGCAGGACCAAGTCGG + Intronic
987379522 5:17272013-17272035 GTGCAGCAGCAGCACAATCTCGG - Intronic
988079656 5:26400160-26400182 ATCCAGCTGCTTCATGATGTTGG + Intergenic
988306261 5:29498482-29498504 CTACAGCTGCAGCAAGGTGTTGG + Intergenic
989457471 5:41660497-41660519 GTCCAGCTGCTTCAGGATGATGG + Intergenic
991610133 5:68441270-68441292 GGGCAGCTGCAACACGATGGCGG - Intergenic
1002902813 6:1424008-1424030 GTCCACCTGCAGCGGGAGGTGGG + Intergenic
1005761228 6:28969958-28969980 GTCAATCTGCAGAACGATGCGGG + Intergenic
1005832888 6:29685058-29685080 GACCATCTGCACCACTATGTAGG + Intergenic
1006495119 6:34417245-34417267 TTCCAACTGCAGCACCATATGGG + Intronic
1006772029 6:36561661-36561683 GTACAGCTGGAGCAAGTTGTGGG - Intergenic
1010325796 6:74560671-74560693 GTCCAGCTGCTTCAGGATGATGG - Intergenic
1011242589 6:85288162-85288184 GTCGATCTGTAGAACGATGTGGG - Intergenic
1014600634 6:123407464-123407486 GTCCTGGTGAAGCACTATGTTGG - Intronic
1015335095 6:132027798-132027820 TTCCAGCTGCAGGAGGATGGCGG + Intergenic
1019666191 7:2253323-2253345 GTCCAGCTGCAGGACCATAGAGG - Exonic
1021070344 7:16230988-16231010 GACCAGCTGCAGCACTAGGTGGG - Intronic
1021988994 7:26124192-26124214 TTCCAGCTGCTTCAGGATGTCGG - Intergenic
1028331910 7:89605268-89605290 TTCCAGCTGCAGCACAGAGTGGG + Intergenic
1031440933 7:121793841-121793863 GTCCAGCTGCTTCAGGATGATGG - Intergenic
1036809537 8:11857930-11857952 GTCCGGTTGCAGCACGCTGGCGG - Intronic
1044536293 8:93359768-93359790 TGCCAGCTGCAGCCAGATGTAGG + Intergenic
1048836322 8:138522313-138522335 GACCAGGAGCAGCAGGATGTGGG + Intergenic
1049123696 8:140766059-140766081 GCCCTGCTGCAGCAGGATTTTGG + Intronic
1049820401 8:144629916-144629938 GTCCAGGTGCAGCACAACGCAGG + Intergenic
1050561103 9:6834969-6834991 GTCCAGATGCAGGATGGTGTGGG - Intronic
1051570699 9:18555459-18555481 TTCCAGTTGCAACAGGATGTAGG - Intronic
1052611027 9:30773880-30773902 GTCAACCTGCAGAACAATGTGGG - Intergenic
1055442899 9:76354118-76354140 GTCCATGTGCAGCACCAGGTTGG - Exonic
1056656383 9:88513097-88513119 GTCCTGCTACATCACCATGTTGG - Intergenic
1057790563 9:98122063-98122085 CCGCAGCTGCAGCACGATGGGGG - Exonic
1058482946 9:105415510-105415532 TTCCAGCTGGAGCAGGATTTTGG + Intronic
1059874483 9:118619124-118619146 GGCCTGCTGCAACACCATGTGGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061681355 9:132243915-132243937 GGCCAGCTGCAGGAGGATGCAGG - Exonic
1186508022 X:10109783-10109805 GGCCAGCTGCTGCTGGATGTTGG - Exonic
1187508587 X:19897461-19897483 GCCCAGCAGCAGCAGCATGTGGG + Intergenic
1193447335 X:81620031-81620053 ATCCAGCTGCATCAGGATGATGG - Intergenic
1194485275 X:94478580-94478602 GTCCAGCTGCTTCAGGATGATGG - Intergenic
1198591850 X:138192188-138192210 GTCAAGCTGCAGCAGCATGCAGG + Intergenic