ID: 1181803552

View in Genome Browser
Species Human (GRCh38)
Location 22:25362001-25362023
Sequence CATGGCCACATGATGTTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181803552_1181803563 4 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803563 22:25362028-25362050 CACAGTCACAATCCGCATGGGGG 0: 1
1: 0
2: 0
3: 6
4: 62
1181803552_1181803564 9 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803564 22:25362033-25362055 TCACAATCCGCATGGGGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 72
1181803552_1181803562 3 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803562 22:25362027-25362049 CCACAGTCACAATCCGCATGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1181803552_1181803560 2 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803560 22:25362026-25362048 CCCACAGTCACAATCCGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 61
1181803552_1181803558 1 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803558 22:25362025-25362047 CCCCACAGTCACAATCCGCATGG 0: 1
1: 0
2: 0
3: 7
4: 82
1181803552_1181803565 10 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803565 22:25362034-25362056 CACAATCCGCATGGGGGCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 79
1181803552_1181803566 11 Left 1181803552 22:25362001-25362023 CCCCTCAACATCATGTGGCCATG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1181803566 22:25362035-25362057 ACAATCCGCATGGGGGCCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181803552 Original CRISPR CATGGCCACATGATGTTGAG GGG (reversed) Exonic
901157902 1:7152758-7152780 CATGGCCACATGAGGCTCTGGGG - Intronic
901245460 1:7726881-7726903 CATGGGCACATGAGGCTCAGAGG - Intronic
901249508 1:7765322-7765344 TATGGCCACCTGATGTAGATGGG - Intronic
904981781 1:34509834-34509856 CATTTCAACATGATGTTTAGGGG - Intergenic
907582102 1:55581741-55581763 CAAGGCCACATGATCTTAAGTGG - Intergenic
907654663 1:56330084-56330106 CAGGGCCACATGATGATTAGTGG - Intergenic
913481894 1:119296583-119296605 CAAGGCCACCTGGTTTTGAGAGG - Intergenic
915882697 1:159688947-159688969 CATGGCCTCATGGTTTGGAGTGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920306573 1:205022005-205022027 CATGGCCACAGGGTGCAGAGAGG + Exonic
923306568 1:232694056-232694078 TATGGCCACAGGATGGGGAGCGG - Intergenic
1065126276 10:22577312-22577334 CATTGCAACATGAGGTTTAGAGG - Intronic
1065416664 10:25495643-25495665 AATGACCAAATGATGATGAGTGG + Intronic
1069065419 10:63937283-63937305 CATGGCCACAATAGGTAGAGGGG + Intergenic
1069147796 10:64917511-64917533 GATGGCCTCATGATGCTGACTGG - Intergenic
1070529251 10:77322227-77322249 CAAGGCCCCTTGTTGTTGAGTGG - Intronic
1070667050 10:78352585-78352607 CATGGCCATATGCTGTGCAGAGG + Intergenic
1070767103 10:79063098-79063120 CATGGCCACAGGATGAGGTGAGG + Intergenic
1070988140 10:80706278-80706300 AATAGCCACATAATGTTGGGTGG + Intergenic
1073540496 10:104313371-104313393 CAGGGCCAGAAGAGGTTGAGAGG + Exonic
1075526440 10:123190997-123191019 CAAGGCCACATGCTGCTAAGAGG - Intergenic
1076107380 10:127834455-127834477 CATGGCCAGAGGGTGTGGAGAGG - Intergenic
1077389421 11:2292847-2292869 CTTGGCCACATCTTGTTGGGTGG - Intergenic
1081714721 11:45241554-45241576 CATGACCAAATGATGATGGGTGG + Exonic
1081959354 11:47123076-47123098 CATGACCTCATGATATTAAGAGG - Intronic
1084082106 11:66834371-66834393 CATTACCAGAGGATGTTGAGTGG - Intronic
1084323097 11:68384423-68384445 CATGGCCACAGGATGCTGGGAGG + Intronic
1084733532 11:71089779-71089801 CAGGGCCAGATGCTGTGGAGAGG + Intronic
1088340463 11:108759891-108759913 TATGGCCACATGTTTTTGTGTGG + Intronic
1091835195 12:3580894-3580916 CATGGCCACATGCTGTCCACAGG - Intronic
1092208567 12:6631784-6631806 CTTGGGCAAATGACGTTGAGGGG + Intronic
1098138806 12:67430662-67430684 GATGGACACATAATTTTGAGGGG - Intergenic
1101615282 12:106330377-106330399 CATGGCCAAATGTTGTGGGGCGG - Intronic
1101931589 12:109018627-109018649 AATGGCCACATGAATCTGAGTGG - Intronic
1102887276 12:116531698-116531720 CTTGAACACATGATGCTGAGTGG + Intergenic
1108111587 13:47079823-47079845 CATGTCCACATGGCCTTGAGTGG + Intergenic
1109152461 13:58861072-58861094 GATGTCCAGAGGATGTTGAGGGG - Intergenic
1109784510 13:67156397-67156419 GATGGCGAGAGGATGTTGAGGGG + Intronic
1113150623 13:107259478-107259500 CATGCCCACAGGACATTGAGAGG + Intronic
1117378240 14:55135289-55135311 CATGCCTGCATGATGTTCAGAGG + Intronic
1118011000 14:61610563-61610585 CCAGGCCACATGATGTTTAACGG + Intronic
1119568126 14:75646185-75646207 GATGACCTCATGATGTTGGGTGG + Intronic
1119900489 14:78255363-78255385 AATGACCACATGATGGTGTGAGG - Intronic
1120401694 14:84040715-84040737 CATGGCCACATCATGCTTGGTGG + Intergenic
1122274001 14:100581863-100581885 CCAGGCCACAGGATGTTGGGAGG + Intronic
1126289082 15:47051628-47051650 GATGGCCACATTATCTTGATAGG + Intergenic
1127762250 15:62150653-62150675 CATGACCACATTATGGTGAATGG + Intergenic
1128025822 15:64435944-64435966 CATGGTGACATGATGTAGAATGG - Intronic
1129818003 15:78573106-78573128 CATTGCCAAATGTTGGTGAGGGG - Intronic
1130375803 15:83327590-83327612 CATGGCCACATGATTCAGAGGGG - Intergenic
1130569745 15:85031244-85031266 CTAGGCCACATAATGATGAGAGG + Intronic
1131533908 15:93217680-93217702 CATGGTCACATGAGGTGGAGAGG + Intergenic
1134229343 16:12416902-12416924 CATTGCAACATGATTTGGAGGGG + Intronic
1135075698 16:19391780-19391802 CTGGGCAACATCATGTTGAGAGG - Intergenic
1135343457 16:21667921-21667943 AATGGCCACCTGATTTTGCGTGG - Intergenic
1135627633 16:24010079-24010101 TGTGGCCACATGATATTGAAAGG + Intronic
1136556795 16:31011625-31011647 CAGGGTCACATGCTGCTGAGAGG - Intergenic
1139382095 16:66538938-66538960 CATGGCCTAATGAGGTTAAGTGG - Intronic
1140404056 16:74695991-74696013 CATGGCCACATCAAGTTGCAAGG - Intronic
1140730625 16:77852623-77852645 GATGGCAATATGATGTTGGGTGG + Intronic
1143456688 17:7072402-7072424 CAGGGCCACAGAATGTAGAGGGG - Intergenic
1145088904 17:19969895-19969917 CATGGGCAGATGCTGCTGAGAGG - Intronic
1147955912 17:44134369-44134391 CATGGCCACATGAAGCAGGGTGG + Intergenic
1149230565 17:54529365-54529387 CATGTCCACATGAATTTGATGGG - Intergenic
1150008626 17:61485626-61485648 CTTGGCCACAAGATGGAGAGAGG + Intergenic
1153991837 18:10407291-10407313 CATTGCCACATAATATTGAATGG - Intergenic
1156639055 18:39067971-39067993 CATAGCCTCATGATGTTAATGGG + Intergenic
1158480253 18:57815533-57815555 CATGACCACATGACGCTGAAGGG - Intergenic
1162122188 19:8477886-8477908 CAAGGTCACATGCTGGTGAGAGG - Intronic
1163289689 19:16371159-16371181 CATGGGCACATGATGGGGAGAGG + Intronic
927381909 2:22489153-22489175 CATGGCCACAAGATGTTTCCTGG + Intergenic
928308147 2:30188210-30188232 CATGGCATCATGAGGTTCAGGGG - Intergenic
928380025 2:30809742-30809764 CATGGCTACAGGTTGGTGAGTGG - Intronic
929398842 2:41555955-41555977 CATGGCCAAATGATTGGGAGTGG + Intergenic
929577379 2:43060567-43060589 CAAGGTCACATGCTGGTGAGTGG + Intergenic
930183685 2:48389642-48389664 CATGGCCACACTATGTTCAGCGG + Intergenic
933569285 2:83990418-83990440 TATGGATACATGATGTTAAGCGG - Intergenic
934553583 2:95276361-95276383 CAGGGGCACATGAGGGTGAGGGG - Intronic
935541553 2:104354442-104354464 CAGGGCCACAGGATGAGGAGAGG + Intergenic
937595180 2:123663611-123663633 AATGGCCAGCTGATGTTAAGGGG - Intergenic
938031289 2:127996370-127996392 CATGGCCACAGGATTGGGAGAGG + Exonic
945651635 2:212568504-212568526 CAAGGACACATGATGTAGTGGGG - Intergenic
947856264 2:233326652-233326674 CATGGTCACCTGCTGTTCAGCGG - Intronic
1168874936 20:1164919-1164941 CACCGCCACATCATGTTGAAGGG + Intronic
1169835191 20:9870070-9870092 CAGGGCCACATGGGGTTCAGGGG + Intergenic
1175062854 20:56259460-56259482 AATGGCCCCATGCTGGTGAGAGG - Intergenic
1179510058 21:41866714-41866736 CATGGCCAGCTGGTGTTGAAGGG + Intronic
1181778039 22:25173974-25173996 CAGGGCCAAAGGATCTTGAGTGG + Intronic
1181803552 22:25362001-25362023 CATGGCCACATGATGTTGAGGGG - Exonic
1181880592 22:25976557-25976579 CCTGGCCACATGCTGTTTATTGG + Intronic
951334653 3:21406240-21406262 CAAGGCCAGAAGATGGTGAGTGG - Intergenic
951930259 3:27957822-27957844 CATGGACACATTGTTTTGAGGGG - Intergenic
952716697 3:36487074-36487096 CCTAGTCACTTGATGTTGAGAGG - Intronic
954745987 3:52787842-52787864 CAAGGGCATGTGATGTTGAGTGG + Intronic
957927100 3:86828330-86828352 GATGGCCACAGGATGTAGTGAGG + Intergenic
959281620 3:104348532-104348554 CAGGACCACTGGATGTTGAGTGG - Intergenic
961918816 3:130404689-130404711 CATGGCCACAGGTTGCTGAGAGG - Intronic
962015035 3:131430905-131430927 AGTGGCCACGTGATGTGGAGGGG + Intergenic
963831885 3:150017313-150017335 CAAGGCCACAGAATGGTGAGAGG - Intronic
968312819 3:197698100-197698122 AATGGCCACATGTTGTAAAGAGG - Intronic
973221138 4:47729548-47729570 CAGGGCCAGATAATGTAGAGTGG + Intronic
974738175 4:65968455-65968477 AATGGGCAAATGATGTAGAGAGG - Intergenic
976498676 4:85760641-85760663 CATTGCCATATGATGTTGTTTGG + Intronic
977082137 4:92544146-92544168 CAGGGCAACATTTTGTTGAGAGG - Intronic
978205936 4:106081472-106081494 CACGGCCACATGGTGGTGAGGGG + Intronic
978830918 4:113083641-113083663 AATGCCCACATGATTTTGATTGG - Intronic
979747700 4:124238407-124238429 AATGGCCACATGGTGCTGATGGG + Intergenic
981872005 4:149497887-149497909 TATTCCCACGTGATGTTGAGTGG + Intergenic
982073323 4:151714902-151714924 CACAGCCACATGAGTTTGAGTGG - Intronic
986963883 5:13246872-13246894 CATGTGCACTTGATGGTGAGAGG - Intergenic
995978992 5:118078704-118078726 AATGGCAACAGAATGTTGAGGGG + Intergenic
996780595 5:127182589-127182611 CACGGCCAAATCATGTTGAGAGG + Intergenic
1003086701 6:3065940-3065962 CAAGGTCACATGATGTCTAGAGG + Intronic
1003304396 6:4913348-4913370 CAGGGCCTCATGCTGTGGAGAGG - Intronic
1003578559 6:7318873-7318895 CCTGGCCACAAGATGTTCACAGG - Intronic
1006844882 6:37055318-37055340 CAAGGCCTAATGATGGTGAGTGG - Intergenic
1007185735 6:39970745-39970767 CATGACCAAATGATATAGAGTGG - Intergenic
1008951730 6:57168482-57168504 CAAGGCCACTTGATGTTGTGTGG - Exonic
1009284701 6:61802156-61802178 CATGACCACATGAGCTTGAAAGG + Intronic
1014540577 6:122670898-122670920 CATAGTCAGATGATGTTCAGTGG + Intronic
1016158689 6:140847878-140847900 CATGGCCAGAAGATGGGGAGCGG + Intergenic
1017815106 6:158010794-158010816 GATGGCCACGTGATGATGGGGGG + Intronic
1017815151 6:158010972-158010994 GATGGCCACGTGATGATGGGAGG + Intronic
1017815162 6:158011009-158011031 AATGGCCACATAATGGTGGGGGG + Intronic
1017815171 6:158011046-158011068 AATGGCCACATAATGGTGGGGGG + Intronic
1019124727 6:169830659-169830681 CATAGCCAGGTGATGGTGAGTGG - Intergenic
1020916670 7:14202348-14202370 AGTAGCCTCATGATGTTGAGAGG - Intronic
1021010562 7:15459404-15459426 CAAGGCCTCAGGATGCTGAGAGG + Intronic
1023701237 7:42893433-42893455 CATGGACTCAGGATGTTGGGGGG + Intergenic
1031890048 7:127283445-127283467 CATGGCTTCATGCAGTTGAGTGG - Intergenic
1032864498 7:135912364-135912386 CAGGGGTACATGATGTTGACAGG + Intergenic
1034324735 7:150220302-150220324 CATGTCCAGAGGAAGTTGAGGGG + Intergenic
1034768456 7:153748929-153748951 CATGTCCAGAGGAAGTTGAGGGG - Intergenic
1039369488 8:36970493-36970515 CATGGAAACATGATGTTTAGAGG + Intergenic
1040525658 8:48222278-48222300 CATGTGCAGATGATGTTGAGGGG + Intergenic
1042789840 8:72592561-72592583 CATGGCCACATGATATACATTGG + Intronic
1044752128 8:95426464-95426486 CATGGACACATGAGGTGCAGGGG + Intergenic
1045880838 8:107038045-107038067 CACTGTCACATGCTGTTGAGAGG + Intergenic
1046722403 8:117635593-117635615 CAGGGCCACATCATGGTCAGAGG + Intergenic
1046804730 8:118467530-118467552 CATGGCCACATGTTCTGCAGGGG - Intronic
1046987392 8:120403443-120403465 CATGGACACATGGGGTTGGGGGG + Intronic
1048796295 8:138152993-138153015 CATGTCCATATGATTTTGTGTGG + Exonic
1048954462 8:139524381-139524403 CATGGCTTCATGATGGGGAGTGG - Intergenic
1049523477 8:143107751-143107773 CATTTCCACATGATATTTAGAGG - Intergenic
1049546648 8:143234893-143234915 GATGGCCCCACCATGTTGAGGGG - Intergenic
1052238089 9:26237173-26237195 CTTGGCTCCATGATGTTTAGGGG + Intergenic
1053475058 9:38376650-38376672 CAAGTCCTCATGATTTTGAGAGG + Intergenic
1054164481 9:61708967-61708989 GATGGCCACATTATCTTGATAGG + Intergenic
1062507998 9:136887613-136887635 TGTGGCCACATGATTTTGAAGGG + Intronic
1187852869 X:23608314-23608336 CATGGCCAAATACTTTTGAGAGG + Intergenic
1191661313 X:63654434-63654456 CATTGGGACATGATGTGGAGTGG - Intronic
1192065137 X:67876335-67876357 CATGGCCTTATTATGTTGACAGG - Intergenic
1193085981 X:77448097-77448119 CAGGGCCCCCTGATGTCGAGAGG - Intronic
1193876497 X:86868727-86868749 TAGGGCCACAGGATCTTGAGTGG - Intergenic
1194307575 X:92267505-92267527 CAAGGCTACATGAAGATGAGGGG + Intronic
1196543422 X:116935676-116935698 GATGGCCACATGATATTGTAAGG - Intergenic