ID: 1181812056

View in Genome Browser
Species Human (GRCh38)
Location 22:25409402-25409424
Sequence TTGGGAGGGGCTCTTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181812056_1181812066 7 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812066 22:25409432-25409454 AGACTGACTGCTGTGGTCAGAGG No data
1181812056_1181812068 17 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812056_1181812070 25 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812070 22:25409450-25409472 AGAGGTGCCCCTGGGGCTTTTGG No data
1181812056_1181812064 0 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812064 22:25409425-25409447 CCTGGCCAGACTGACTGCTGTGG No data
1181812056_1181812069 18 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812069 22:25409443-25409465 TGTGGTCAGAGGTGCCCCTGGGG No data
1181812056_1181812067 16 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812067 22:25409441-25409463 GCTGTGGTCAGAGGTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181812056 Original CRISPR TTGGGAGGGGCTCTTGTGCC CGG (reversed) Intergenic
No off target data available for this crispr