ID: 1181812058

View in Genome Browser
Species Human (GRCh38)
Location 22:25409415-25409437
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181812058_1181812066 -6 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812066 22:25409432-25409454 AGACTGACTGCTGTGGTCAGAGG No data
1181812058_1181812068 4 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812058_1181812070 12 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812070 22:25409450-25409472 AGAGGTGCCCCTGGGGCTTTTGG No data
1181812058_1181812067 3 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812067 22:25409441-25409463 GCTGTGGTCAGAGGTGCCCCTGG No data
1181812058_1181812069 5 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812069 22:25409443-25409465 TGTGGTCAGAGGTGCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181812058 Original CRISPR CAGTCTGGCCAGGTTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr