ID: 1181812061

View in Genome Browser
Species Human (GRCh38)
Location 22:25409420-25409442
Sequence GCAGTCAGTCTGGCCAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181812061_1181812068 -1 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812061_1181812070 7 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812070 22:25409450-25409472 AGAGGTGCCCCTGGGGCTTTTGG No data
1181812061_1181812067 -2 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812067 22:25409441-25409463 GCTGTGGTCAGAGGTGCCCCTGG No data
1181812061_1181812074 28 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812074 22:25409471-25409493 GGAGCCACAGCATCTTCCTGAGG No data
1181812061_1181812069 0 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812069 22:25409443-25409465 TGTGGTCAGAGGTGCCCCTGGGG No data
1181812061_1181812075 29 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812075 22:25409472-25409494 GAGCCACAGCATCTTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181812061 Original CRISPR GCAGTCAGTCTGGCCAGGTT GGG (reversed) Intergenic
No off target data available for this crispr