ID: 1181812064

View in Genome Browser
Species Human (GRCh38)
Location 22:25409425-25409447
Sequence CCTGGCCAGACTGACTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181812056_1181812064 0 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812064 22:25409425-25409447 CCTGGCCAGACTGACTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181812064 Original CRISPR CCTGGCCAGACTGACTGCTG TGG Intergenic
No off target data available for this crispr