ID: 1181812066

View in Genome Browser
Species Human (GRCh38)
Location 22:25409432-25409454
Sequence AGACTGACTGCTGTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181812059_1181812066 -7 Left 1181812059 22:25409416-25409438 CCCTCCCAACCTGGCCAGACTGA No data
Right 1181812066 22:25409432-25409454 AGACTGACTGCTGTGGTCAGAGG No data
1181812058_1181812066 -6 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812066 22:25409432-25409454 AGACTGACTGCTGTGGTCAGAGG No data
1181812056_1181812066 7 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812066 22:25409432-25409454 AGACTGACTGCTGTGGTCAGAGG No data
1181812060_1181812066 -8 Left 1181812060 22:25409417-25409439 CCTCCCAACCTGGCCAGACTGAC No data
Right 1181812066 22:25409432-25409454 AGACTGACTGCTGTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181812066 Original CRISPR AGACTGACTGCTGTGGTCAG AGG Intergenic
No off target data available for this crispr