ID: 1181812068

View in Genome Browser
Species Human (GRCh38)
Location 22:25409442-25409464
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181812059_1181812068 3 Left 1181812059 22:25409416-25409438 CCCTCCCAACCTGGCCAGACTGA No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812061_1181812068 -1 Left 1181812061 22:25409420-25409442 CCCAACCTGGCCAGACTGACTGC No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812063_1181812068 -6 Left 1181812063 22:25409425-25409447 CCTGGCCAGACTGACTGCTGTGG No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812062_1181812068 -2 Left 1181812062 22:25409421-25409443 CCAACCTGGCCAGACTGACTGCT No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812058_1181812068 4 Left 1181812058 22:25409415-25409437 CCCCTCCCAACCTGGCCAGACTG No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812056_1181812068 17 Left 1181812056 22:25409402-25409424 CCGGGCACAAGAGCCCCTCCCAA No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data
1181812060_1181812068 2 Left 1181812060 22:25409417-25409439 CCTCCCAACCTGGCCAGACTGAC No data
Right 1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181812068 Original CRISPR CTGTGGTCAGAGGTGCCCCT GGG Intergenic
No off target data available for this crispr