ID: 1181813688

View in Genome Browser
Species Human (GRCh38)
Location 22:25421086-25421108
Sequence GCTGCTGGGGCGCGCAGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181813678_1181813688 18 Left 1181813678 22:25421045-25421067 CCGCGACCCTGGCGGGCTACAGA No data
Right 1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG No data
1181813685_1181813688 -10 Left 1181813685 22:25421073-25421095 CCGCTTGCAGGGCGCTGCTGGGG No data
Right 1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG No data
1181813679_1181813688 12 Left 1181813679 22:25421051-25421073 CCCTGGCGGGCTACAGATTACAC No data
Right 1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG No data
1181813680_1181813688 11 Left 1181813680 22:25421052-25421074 CCTGGCGGGCTACAGATTACACC No data
Right 1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181813688 Original CRISPR GCTGCTGGGGCGCGCAGAGC GGG Intergenic
No off target data available for this crispr