ID: 1181818765

View in Genome Browser
Species Human (GRCh38)
Location 22:25459450-25459472
Sequence CTGCAGTACCTGCTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181818752_1181818765 27 Left 1181818752 22:25459400-25459422 CCCTCTGGCCCTGCAGGTGGGTT 0: 1
1: 1
2: 3
3: 20
4: 240
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data
1181818761_1181818765 -8 Left 1181818761 22:25459435-25459457 CCTGGCTACCGTGGGCTGCAGTA No data
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data
1181818756_1181818765 18 Left 1181818756 22:25459409-25459431 CCTGCAGGTGGGTTGGCTACTAG 0: 1
1: 1
2: 1
3: 4
4: 68
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data
1181818751_1181818765 28 Left 1181818751 22:25459399-25459421 CCCCTCTGGCCCTGCAGGTGGGT 0: 1
1: 0
2: 2
3: 41
4: 292
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data
1181818753_1181818765 26 Left 1181818753 22:25459401-25459423 CCTCTGGCCCTGCAGGTGGGTTG No data
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data
1181818755_1181818765 19 Left 1181818755 22:25459408-25459430 CCCTGCAGGTGGGTTGGCTACTA 0: 1
1: 1
2: 1
3: 6
4: 58
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data
1181818760_1181818765 -7 Left 1181818760 22:25459434-25459456 CCCTGGCTACCGTGGGCTGCAGT 0: 1
1: 1
2: 1
3: 11
4: 126
Right 1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181818765 Original CRISPR CTGCAGTACCTGCTGGAGAA GGG Intergenic
No off target data available for this crispr