ID: 1181826386

View in Genome Browser
Species Human (GRCh38)
Location 22:25519680-25519702
Sequence CCTTGCTAGCGTACTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181826378_1181826386 24 Left 1181826378 22:25519633-25519655 CCAGCATTCTCTGCTGCACCTGG 0: 1
1: 2
2: 2
3: 21
4: 341
Right 1181826386 22:25519680-25519702 CCTTGCTAGCGTACTCCTCATGG 0: 1
1: 0
2: 0
3: 2
4: 34
1181826381_1181826386 6 Left 1181826381 22:25519651-25519673 CCTGGAAGGTACTAGACACCCTG No data
Right 1181826386 22:25519680-25519702 CCTTGCTAGCGTACTCCTCATGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181826386 Original CRISPR CCTTGCTAGCGTACTCCTCA TGG Intergenic
915509687 1:156379797-156379819 CCTTGCTGGCTTACACCACAGGG + Intronic
1062827979 10:586388-586410 CCTTGCTAGGGGCTTCCTCAGGG + Intronic
1063012959 10:2043659-2043681 CCTTGCTAGGGCGCTCCACATGG + Intergenic
1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG + Intergenic
1064357278 10:14631252-14631274 CCTTCCTAGTTTACTCCTCCAGG + Intronic
1076016213 10:127029349-127029371 CTTTGCTAGCCTCCTCTTCAGGG - Intronic
1081516796 11:43840028-43840050 CCTTGCTCCTATACTCCTCATGG - Exonic
1082633874 11:55572901-55572923 CCTTGCAACCGTATTCCCCATGG + Exonic
1083306778 11:61765674-61765696 CCTTGCTGATGTACTCCTCCAGG - Exonic
1084234242 11:67776183-67776205 CCTTGCCACCGCACTCCCCATGG + Intergenic
1090889289 11:130908932-130908954 CTATGCTAGCTTACTCCTTATGG - Intronic
1096194961 12:49643884-49643906 CCTTGCCAGCTTTCTCCTCAGGG - Exonic
1102526056 12:113513055-113513077 CCTTCCCTGCGTGCTCCTCATGG + Intergenic
1112530294 13:100195198-100195220 CATTGCTAAGGTCCTCCTCATGG - Intronic
1127779448 15:62298550-62298572 CTTTGCTAGAATCCTCCTCAAGG + Intergenic
1132975915 16:2711158-2711180 CCTTCCTAACGTCCTTCTCACGG + Intergenic
1155131744 18:22941679-22941701 CCTTTAAAGTGTACTCCTCATGG + Intronic
1167406384 19:49311297-49311319 CCTTGCTGGCAAACACCTCATGG - Exonic
930002101 2:46868546-46868568 CCTTCCTAGCGCTCTCCTGATGG + Intergenic
947872196 2:233445517-233445539 CATTGCTAACGTAACCCTCACGG + Intronic
948599770 2:239101570-239101592 CCTTCCTAGGGTCCTGCTCAGGG + Intronic
948712318 2:239832922-239832944 CCTTGCTAGTGCTCTCCTCCGGG + Intergenic
1171008137 20:21488481-21488503 CCTTGCTCCTATACTCCTCATGG + Intergenic
1171850033 20:30301426-30301448 CCTTGCTGGGGTTCTCCTCTGGG + Intergenic
1179173270 21:38989545-38989567 CCCTGCCACCGTACTCCTCAAGG + Intergenic
1181826386 22:25519680-25519702 CCTTGCTAGCGTACTCCTCATGG + Intergenic
950484063 3:13262478-13262500 CCGTCCTAGCGTAACCCTCAAGG - Intergenic
952530287 3:34256073-34256095 CCTGGCCAGCGTACTCAGCAAGG - Intergenic
953726760 3:45406288-45406310 CCTTTTTAGCAAACTCCTCAGGG - Intronic
961883871 3:130082727-130082749 CCTTGCCACCGCACTCCCCATGG + Intronic
984591711 4:181624904-181624926 CCTGGCTTGCTTTCTCCTCAAGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
994719463 5:103364344-103364366 CCCTTCTAGGCTACTCCTCAGGG + Intergenic
1005511880 6:26518754-26518776 CCTTGCTCCTGTACTCCTCCTGG + Intergenic
1006609855 6:35287824-35287846 CCTTGCTGGCATACTGCTCCAGG - Exonic
1018344093 6:162882621-162882643 CCCAGCTTGCCTACTCCTCAGGG - Intronic
1187369952 X:18696937-18696959 CAATTCTAGCATACTCCTCAGGG + Intronic