ID: 1181826434

View in Genome Browser
Species Human (GRCh38)
Location 22:25519993-25520015
Sequence GTGTGTTGCAGAGGTCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181826434_1181826440 22 Left 1181826434 22:25519993-25520015 CCACGCAGACCTCTGCAACACAC No data
Right 1181826440 22:25520038-25520060 ACGACCCATCAACTACAAGAAGG 0: 1
1: 0
2: 1
3: 3
4: 44
1181826434_1181826441 25 Left 1181826434 22:25519993-25520015 CCACGCAGACCTCTGCAACACAC No data
Right 1181826441 22:25520041-25520063 ACCCATCAACTACAAGAAGGAGG 0: 1
1: 1
2: 0
3: 7
4: 104
1181826434_1181826443 26 Left 1181826434 22:25519993-25520015 CCACGCAGACCTCTGCAACACAC No data
Right 1181826443 22:25520042-25520064 CCCATCAACTACAAGAAGGAGGG 0: 1
1: 1
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181826434 Original CRISPR GTGTGTTGCAGAGGTCTGCG TGG (reversed) Intergenic
No off target data available for this crispr