ID: 1181826535

View in Genome Browser
Species Human (GRCh38)
Location 22:25520771-25520793
Sequence ATAGAAAGGCAGACTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 479}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181826530_1181826535 18 Left 1181826530 22:25520730-25520752 CCAGGTAAGAATCTGTTCTAGGA 0: 1
1: 1
2: 0
3: 11
4: 130
Right 1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181826535 Original CRISPR ATAGAAAGGCAGACTGGAGA AGG Intergenic
901295253 1:8156296-8156318 GTAGAAAGGCATCCTGGAGCTGG - Intergenic
901958082 1:12801720-12801742 AAAGAAAGACAGACAGGACAGGG - Intergenic
902930626 1:19728769-19728791 ATGGAAAGGCAGAGTGGGGCAGG - Intronic
903259735 1:22124941-22124963 CTGGAAAGGCAGACTGGGCAGGG - Intronic
903613694 1:24636303-24636325 GTAGAAAGGCAAAGTGGGGAGGG + Intronic
904801857 1:33098737-33098759 ATAGGAAGACACAATGGAGAGGG - Intronic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
904979210 1:34482711-34482733 ATAGAAAGACAGAAAGCAGATGG + Intergenic
905358444 1:37401435-37401457 ATAGAAGCCCAGACTGCAGAAGG - Intergenic
905609713 1:39339759-39339781 GTAGAAAGACAGCCTTGAGAGGG + Intronic
906031285 1:42722254-42722276 ATTCAAAGGCAGACTTGAGCAGG + Intergenic
907623757 1:56009303-56009325 ATAGGAAGGCACCCTAGAGAGGG + Intergenic
908491414 1:64647996-64648018 AGAGAAGGGCAGGCTGAAGACGG - Exonic
908687681 1:66740160-66740182 ATAAAAAGGCACACTAGAGAAGG + Intronic
908769240 1:67581290-67581312 ATAGAAAGGGAGTCGGGGGAAGG + Intergenic
908974506 1:69881586-69881608 ATAAAAAGGCAGGCTGGGTATGG + Intronic
909762518 1:79309562-79309584 ATAGAAAAGCAGCATGGTGATGG + Intergenic
909878113 1:80836774-80836796 ATAGAAAGGCTAACTAGAGAAGG + Intergenic
909987427 1:82178755-82178777 AGGGAAAGGCAGAGAGGAGAGGG - Intergenic
910276175 1:85451343-85451365 ATATAAAGGCAGAAAGAAGAGGG + Intronic
910500663 1:87886533-87886555 ATAGAAAAGTGGGCTGGAGAAGG + Intergenic
910738381 1:90487802-90487824 ATAGAATGGAAGCCTAGAGAAGG - Intergenic
911984573 1:104604742-104604764 ATAGAAAGAAAGAATGAAGAGGG - Intergenic
912886579 1:113480674-113480696 ATAAGAAGGCACACTGAAGACGG - Intronic
913478698 1:119263876-119263898 ATAGAAGGGGAGGCTGGGGAGGG - Intergenic
915519148 1:156431161-156431183 GGAGAAAGGCAGACTCCAGAGGG - Intergenic
915529752 1:156496564-156496586 AGAGAAGGGCTGACTGGAGCAGG - Intronic
915724353 1:158007261-158007283 ATAGAAAGAGACACTGGAGCTGG + Intronic
915926877 1:160028972-160028994 ATAGAAATGCAGACCTGTGAGGG - Exonic
916007330 1:160674482-160674504 AAAGACAGGCAGGCTGGAGTTGG + Intergenic
916418280 1:164612507-164612529 ATAGAAAGGGAAACTGGCTATGG + Intronic
916584585 1:166139519-166139541 ATAGAGGGGCAGAGTCGAGAGGG + Intronic
916624271 1:166536950-166536972 ATAGAAAGGCACAGTTGACAAGG + Intergenic
916957359 1:169852901-169852923 ATTGAAAGCCAGGCTGGAGCAGG - Exonic
917921841 1:179757235-179757257 ACCGAAAGGTAGAGTGGAGATGG + Intronic
918416772 1:184317454-184317476 AGAGAAAGGGAGAAAGGAGAGGG + Intergenic
918902230 1:190437552-190437574 ATAGTAGGGCAGAGAGGAGAAGG - Intronic
919169580 1:193937292-193937314 ATAGAAAGGGAAAGTGGGGATGG - Intergenic
919688382 1:200506075-200506097 AGAGACATGCAAACTGGAGATGG + Intergenic
920221856 1:204410216-204410238 ATGGAAAAGGAGCCTGGAGAGGG - Exonic
920270657 1:204761128-204761150 TTAGAAAGAAAGAATGGAGATGG + Intergenic
920955552 1:210617456-210617478 AGAGATATGCAGACTGGAGGTGG + Intronic
923405060 1:233651715-233651737 ATAGACAGGCAGATGGGAGCAGG + Intronic
923763693 1:236872314-236872336 AAGGAAAGGCAGACTCTAGATGG - Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
1062778030 10:171834-171856 ATTGAAAGGCAGTGTGGTGAGGG - Intronic
1063109385 10:3021262-3021284 TTAGAGAGGAAGACTGGAGATGG - Intergenic
1063286765 10:4697103-4697125 ATAGAAATGGAGAATGCAGAAGG + Intergenic
1063564882 10:7163919-7163941 AAAGAAAGGCAGGTTAGAGAAGG + Intronic
1063678432 10:8162742-8162764 AGAGAAAGCCAGAAAGGAGAAGG + Intergenic
1064669715 10:17699324-17699346 ATGGAAAGGAAGACAGGAGGGGG - Intronic
1064819009 10:19302616-19302638 AGAGAAAGGTAGAATGGATAAGG + Intronic
1065741105 10:28797886-28797908 AAAAAAAGGCAGAGGGGAGAGGG + Intergenic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1069068975 10:63974853-63974875 ATAGAAGGGCAGACAGGACTGGG - Intergenic
1069377222 10:67805548-67805570 ATATAACTGCAGAATGGAGAAGG - Intronic
1069481178 10:68783690-68783712 TTAGAAATGCAGCCTGAAGATGG + Intronic
1069811333 10:71162137-71162159 ATCCAAGGACAGACTGGAGAAGG + Intergenic
1069955634 10:72049596-72049618 ATAGACAGGCACAGAGGAGAAGG + Intergenic
1070465100 10:76713522-76713544 ATAGAACTGCAGAATGGATATGG + Intergenic
1070507619 10:77128142-77128164 ATACACAGGCAGACTGGCAAAGG - Intronic
1070589916 10:77794381-77794403 ACAGAAAGGCAAAATGGAGCAGG + Intronic
1070658094 10:78284898-78284920 GGAGAAAGGAAGACAGGAGATGG - Intergenic
1070756586 10:78997183-78997205 AGAGTAATGCAGACTGGAGAAGG - Intergenic
1071294022 10:84206300-84206322 AAAGATGGGCAGCCTGGAGAAGG + Intronic
1071421994 10:85510144-85510166 AGAGAAAGGCATACTGGTGAGGG + Intergenic
1071757080 10:88555237-88555259 AATGAAAGCCAGATTGGAGAAGG - Intronic
1072402724 10:95122045-95122067 CTAAAAAGGCAGTCTGGATAAGG + Intergenic
1072682125 10:97515175-97515197 AAAGAAAGGCAGGCAGGAGCAGG - Intronic
1072852545 10:98911429-98911451 AAAGAAAGGAACACTGGAGCTGG + Intronic
1072999450 10:100276308-100276330 AGAGAGAGGGAGACGGGAGAGGG - Intronic
1073455009 10:103631454-103631476 ATAGAAAGCAAAACTGCAGATGG + Intronic
1073546701 10:104354973-104354995 TTATAAAGCTAGACTGGAGATGG - Intronic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076415802 10:130287577-130287599 AGAGAAGGGGAGACTAGAGACGG + Intergenic
1077739501 11:4829790-4829812 AGAGACAGGCAGACTTGAGGTGG - Intronic
1077934228 11:6767054-6767076 ATAGAAAGAAAGAATGGAAAAGG - Intergenic
1078570738 11:12455908-12455930 GTACCCAGGCAGACTGGAGAAGG - Intronic
1078811840 11:14776034-14776056 AGAGGAAGGCAGACTGGCTAGGG + Intronic
1079845253 11:25458230-25458252 AGAGGAAGGCAGACTTGAGTTGG + Intergenic
1080103967 11:28492221-28492243 CTAGAAAGCTAGAATGGAGAGGG - Intergenic
1080522828 11:33082649-33082671 AGAGAAAGGTAGATTAGAGAAGG - Intronic
1081058555 11:38442759-38442781 CTAGAAAGGCAGATTTGAAATGG + Intergenic
1081629361 11:44678277-44678299 ACAGAAACACAGAGTGGAGAAGG - Intergenic
1081926444 11:46833337-46833359 AGAGAAAGGCTGATTGGAAAGGG + Intronic
1085041494 11:73328927-73328949 CTAGAGAGGCAGGATGGAGAAGG + Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1086145649 11:83548353-83548375 AGAGAAAGGCAGAATAGAGATGG + Intronic
1086431437 11:86740510-86740532 ATAGCAGTGCAGACTGGATATGG + Intergenic
1087093666 11:94300124-94300146 ATAGGAAGGAAGAGAGGAGAGGG + Intergenic
1087128502 11:94649320-94649342 GTTGCAAGCCAGACTGGAGAAGG + Intergenic
1087483233 11:98728686-98728708 AATGAAAGGCAGCCTGCAGACGG + Intergenic
1088638046 11:111843551-111843573 GTAGAAAAGCAGAATGGAGGTGG + Intronic
1088698649 11:112392169-112392191 ATAAAAAGGGAAACTGGAAATGG - Intergenic
1088850711 11:113700969-113700991 AGAGAAGTGCAGAGTGGAGAGGG - Intronic
1089819614 11:121212887-121212909 ATAGAAAGTTGGACTGGAAAGGG + Intergenic
1090477776 11:127039088-127039110 AGAGAAAGGCAGGTTGGAGTTGG + Intergenic
1091218799 11:133918913-133918935 AGAGAAAGACTGACTGGAGAAGG + Intronic
1091433575 12:456516-456538 ATGGAAGGTCAGACTGGAGAAGG + Intergenic
1091495677 12:970656-970678 TTAGAAAGGCAGTTGGGAGAGGG + Intronic
1092487602 12:8915397-8915419 ATAGGAAGGGGGACGGGAGAAGG - Intronic
1093015501 12:14150720-14150742 GTAGAAACACAGGCTGGAGATGG - Intergenic
1093342834 12:17998965-17998987 ATGGATAGGCAAACTGGTGAAGG + Intergenic
1093409527 12:18847669-18847691 ATAGAAAGGAAGACATGAGGAGG + Intergenic
1095136933 12:38615936-38615958 ATAGAAAGGAAAAAAGGAGAGGG + Intergenic
1095379863 12:41577861-41577883 ATATATAGGTAGACTGGAAAGGG - Intergenic
1095717046 12:45357682-45357704 AAAGAAAGGAGGACTGGAGGCGG + Intronic
1096002795 12:48143474-48143496 TTGGAAAGGGAGATTGGAGAGGG + Intronic
1096037040 12:48481689-48481711 GCAGAAATGCAGAGTGGAGAAGG - Intergenic
1096479817 12:51932026-51932048 ATGGAAAGGGGGATTGGAGAAGG + Intergenic
1097284060 12:57864370-57864392 ATGGAAAGGCAGGGTGGAGAAGG - Intergenic
1097759230 12:63441733-63441755 GCAGAAAGGGAAACTGGAGAAGG + Intergenic
1097851582 12:64415941-64415963 ATAGAAAGCCACACTGCAGAAGG - Intronic
1098362567 12:69668973-69668995 AGAGAAAAGCAGACCTGAGAGGG + Intronic
1098944052 12:76570915-76570937 AAAGAAAGTCAGAATGTAGAAGG - Intergenic
1100044038 12:90356849-90356871 AAAGAAAGACTGACAGGAGAAGG - Intergenic
1100380475 12:94057157-94057179 ATAGAATGGAAGGCTGGTGAGGG - Intergenic
1101242022 12:102848386-102848408 CTAGAAAGGCTGAGTGTAGATGG + Intronic
1101513933 12:105417451-105417473 ATAGAAAGCTAGACATGAGAAGG + Intergenic
1101548674 12:105741139-105741161 ATAGAAAGTCAGGCAGGAGAAGG + Intergenic
1102033459 12:109758016-109758038 CAAGAAAGTCAGGCTGGAGAGGG + Intronic
1102054677 12:109887662-109887684 ATGGAAAGGCAGACTGGCAGGGG - Intergenic
1102234538 12:111286009-111286031 TTAGAAAGTCACACTGGGGAGGG - Intronic
1102713746 12:114952230-114952252 CAAGAAAGGCAGAGTGTAGATGG - Intergenic
1103887057 12:124210411-124210433 AGAGAAAGGGAGACTTAAGATGG - Intronic
1104496072 12:129240536-129240558 ATATAAAGGAAGAATGAAGAAGG + Intronic
1104804921 12:131581618-131581640 ACAGACAGGCAGAGTGCAGAGGG - Intergenic
1105350179 13:19607883-19607905 AAACAAAGGCAGAATGGAGGAGG - Intergenic
1106525295 13:30535138-30535160 AGAGAAAGGCTGAGTGGGGAAGG - Intronic
1107684816 13:42886226-42886248 ATAGTCAGGCAGACAGGAGCAGG - Intergenic
1108918214 13:55642471-55642493 AGAGAAAGGCAGACCCAAGAAGG - Intergenic
1111525876 13:89468758-89468780 ATATAAAGGCAAACTACAGATGG - Intergenic
1112188725 13:97154199-97154221 AAAAAAAGTTAGACTGGAGATGG + Intergenic
1112999583 13:105618567-105618589 ATAGAAAGATAGAGTGGAGAAGG + Intergenic
1113499813 13:110764364-110764386 GTAGAAAGGCAGATTGGCCATGG + Intergenic
1114589143 14:23843707-23843729 TGAGAAAGACAGACTGCAGATGG + Intergenic
1115937974 14:38576479-38576501 ACAGAATGGCAGAATGGATAAGG - Intergenic
1115954250 14:38760153-38760175 ATATTAAGGAAGACTGCAGATGG - Intergenic
1116317153 14:43412027-43412049 ATAGGAAGAGACACTGGAGAGGG + Intergenic
1117629225 14:57671933-57671955 ACAGGAAGCCAGACTGGAAAGGG - Intronic
1119560953 14:75589419-75589441 AAAGAAGGGCACACTGGGGAAGG + Intronic
1119611791 14:76069520-76069542 ATAGAAGGTGAGACTGAAGATGG + Intronic
1119885696 14:78139502-78139524 AAAGCAAGGCTGACTAGAGAAGG - Intergenic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120013218 14:79441203-79441225 ATAGAAACCCATACTTGAGAAGG + Intronic
1120156656 14:81100861-81100883 ATACAAAGCCAGAGAGGAGAGGG - Intronic
1120721538 14:87894390-87894412 ATTGATAGGGAGAATGGAGAAGG + Intronic
1120921601 14:89760662-89760684 AAAGCAAGGAAGACGGGAGAAGG + Intergenic
1120991124 14:90378378-90378400 ATAGATAGGGAGACTAGTGAAGG - Intergenic
1121050991 14:90818806-90818828 CTGGAGAGGCAGACTGGAGTTGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121451283 14:94009769-94009791 CTAGAATGTCAGACTGGAGTGGG - Intergenic
1121833642 14:97073016-97073038 AGAGAAAGGCAGAAAAGAGAGGG - Intergenic
1121839624 14:97122355-97122377 AGGGAAAGCAAGACTGGAGATGG - Intergenic
1122013680 14:98774739-98774761 AGAAAAAGGCAGATTGGGGAAGG - Intergenic
1124069511 15:26378462-26378484 ATAGAAAGGAAGAAAGGAAAGGG - Intergenic
1125425276 15:39542592-39542614 AGAGGAAGGCAGAAGGGAGAGGG - Intergenic
1126234904 15:46372611-46372633 ATAGAAATGGAGACTCCAGAAGG + Intergenic
1127743351 15:61937053-61937075 AGAGAGAGACAGAATGGAGATGG - Intronic
1128868726 15:71136294-71136316 CTAGAATGTCAGACTGGGGACGG + Intronic
1129234833 15:74217819-74217841 ATAGAAGGGCAGATGAGAGATGG + Intergenic
1130862830 15:87906333-87906355 ACAGAAAGGCAGATGGGAGAAGG + Intronic
1131456899 15:92588651-92588673 ATAGAAAGGAAGAAAGGTGAGGG - Intergenic
1131685923 15:94767496-94767518 AAAGAAAGAGAGACAGGAGAGGG + Intergenic
1131797015 15:96029494-96029516 AGAGAAAGGCAGGTTGGAAAGGG - Intergenic
1132126448 15:99230399-99230421 AAAGAAAAGCAGACTAGAGGAGG + Intronic
1132769318 16:1552159-1552181 GTAGAAAGGAAGCCTGGTGAGGG + Intronic
1133985930 16:10668255-10668277 TTAGAAAGGCAGACGGGCAAAGG + Intronic
1134267926 16:12707660-12707682 AAAGAAAGGCTGACTTGGGAAGG + Intronic
1135247474 16:20869305-20869327 GTACAAATGCAGACAGGAGAAGG + Intronic
1135567114 16:23519627-23519649 AGAGAAAGGCAGCCTGCAGAGGG + Intronic
1135708795 16:24697743-24697765 TTAGAAATGCAGACTGGGGCCGG + Intergenic
1135871380 16:26154544-26154566 GTAGAAAGGCAGCTTGGGGATGG - Intergenic
1136749420 16:32619865-32619887 AGAGAGAGACAGACTGCAGAAGG - Intergenic
1137339054 16:47581409-47581431 ATAGATAGACAGACAGGAGTAGG + Intronic
1137817187 16:51409686-51409708 ACAGAAAGGAGGGCTGGAGATGG - Intergenic
1138034916 16:53594388-53594410 ATAGAAGTGCAGAATGAAGAGGG - Intergenic
1138278113 16:55750990-55751012 GTAGATAGTCAGACTAGAGAGGG + Intergenic
1138350978 16:56346064-56346086 AGAGAAAGGCAGGCTGGGGATGG - Exonic
1138406901 16:56802970-56802992 AAAGAAAGGAAGTCTGGGGAGGG - Intronic
1138980053 16:62257296-62257318 ACAGACAGGGAGACGGGAGAAGG - Intergenic
1139156834 16:64453596-64453618 ATAGAAAGGTACACAAGAGATGG + Intergenic
1139401269 16:66683766-66683788 ATAGTAAGGCAGAGTGGGGTGGG + Intronic
1139954633 16:70687185-70687207 TGAGAAAGGCAGATTGGGGAAGG + Intergenic
1140041317 16:71410137-71410159 ATGGAAAGCCAGGGTGGAGACGG - Intergenic
1140121420 16:72086117-72086139 ACAGTAATACAGACTGGAGATGG + Exonic
1140184873 16:72759849-72759871 ATTCAAAGGCAGATTTGAGAAGG - Intergenic
1140282970 16:73572496-73572518 ACAGAAAGGCAGGAAGGAGAAGG + Intergenic
1140317050 16:73908586-73908608 ATAGAAAGGCAGAATGTTCAAGG + Intergenic
1140975774 16:80058602-80058624 GTAGGAAGGAAGACTGGAGAAGG + Intergenic
1141761311 16:86030416-86030438 GTAGAAAGGAAGACAGGGGACGG + Intergenic
1143418068 17:6764801-6764823 ATGGAGAGCCAGACTGGAGTGGG - Intronic
1143618586 17:8068149-8068171 ACAGAAAGACAAACTTGAGAGGG - Intergenic
1143777850 17:9211192-9211214 AAAGGAAGGGAGACTGGAGCTGG - Intronic
1144802433 17:17939167-17939189 AGAGAAAGTCACACTAGAGAGGG - Intronic
1145751316 17:27357003-27357025 ATGCAAAGGCAGGCTGGACATGG - Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146637281 17:34515719-34515741 AGAGAAAGGAAGGCTGGAAAAGG - Intergenic
1148503142 17:48107221-48107243 AGTGAAAGTCAGACTCGAGAGGG - Intronic
1148681878 17:49478856-49478878 AGAGACAGGGAGACAGGAGAAGG + Intergenic
1148938479 17:51185397-51185419 ATTGTAAGGAAGACTGCAGAAGG - Intronic
1148967407 17:51447400-51447422 CTAGAAAGGCAGTCTGGCTATGG - Intergenic
1148974490 17:51515131-51515153 ATTCAAAGGCAGTCTGGAGCTGG + Intergenic
1149572692 17:57684902-57684924 ATGGAAGAGCAGACGGGAGAGGG + Intergenic
1150474966 17:65467911-65467933 ATAGGATGGCACACTGGTGATGG - Intergenic
1150474983 17:65468035-65468057 ATAGGATGGCACACTGGTGATGG - Intergenic
1150606750 17:66698074-66698096 ATAGACAGGCTGACTGGTGAAGG + Intronic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1152093628 17:78260133-78260155 ATAGATAGACAGATTTGAGATGG + Intergenic
1152937826 17:83150829-83150851 AAAGAAAGCCAGACTGAGGATGG - Intergenic
1153409433 18:4777301-4777323 AGAGAAAGGCAGGCAGTAGAAGG + Intergenic
1156741511 18:40335898-40335920 ATTCAAAGGCAGACTTGAGCAGG - Intergenic
1157021275 18:43785184-43785206 ATAGATAGGCTGAGTGGAAAAGG - Intergenic
1157313464 18:46569710-46569732 ATAGGAGGGCAGCCTGGAGCTGG + Intronic
1158050572 18:53212960-53212982 ATTGAAAGGCAGGCTGGGCATGG - Intronic
1158261170 18:55607459-55607481 GAAGAAAGGCAGCCTGGAGCAGG - Intronic
1158610650 18:58937267-58937289 AAAGAAAGGCAGACTTCAAACGG - Intronic
1158660867 18:59386356-59386378 ATAGAAAAGCATAAAGGAGAAGG + Intergenic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159560499 18:69987624-69987646 CTAGCAAGGCTGACTGGTGAAGG + Intergenic
1159909771 18:74134713-74134735 CTAGAAATGCAGACTAGGGATGG + Intronic
1160129576 18:76212844-76212866 ATAGAAAGGAAGGAGGGAGATGG - Intergenic
1160890359 19:1374528-1374550 AGAGAAAGGCAGACCTGAGGAGG - Intronic
1160943297 19:1630042-1630064 ATAGCCAGGCAGCTTGGAGAGGG - Intronic
1161337062 19:3720434-3720456 AAAGAAAGGCTGCCTGGAGGAGG - Intronic
1162398538 19:10431572-10431594 TTAGAAAGCCAGACTGGATGTGG - Intronic
1162568241 19:11456025-11456047 ACACAAAGGCAGAGTGGAAAGGG - Intronic
1162607589 19:11722545-11722567 ATGATAAGGCACACTGGAGACGG - Exonic
1162681862 19:12350545-12350567 ATGATAAGGCACACTGGAGATGG - Exonic
1162885771 19:13695928-13695950 AAAGAAAGGCAGACAGGAAAAGG + Intergenic
1163107553 19:15134373-15134395 TTTGAAAGGCAGAGTTGAGAGGG - Intergenic
1163921611 19:20295777-20295799 AAAGAGAGGCAGAGGGGAGAGGG - Intergenic
1164320524 19:24140208-24140230 ACAGAAAGGTGGACAGGAGAGGG - Intergenic
1164532663 19:29060054-29060076 CAAGAATGGGAGACTGGAGAAGG + Intergenic
1164770965 19:30808620-30808642 AGAGAAAGGCAGAGTTGGGATGG + Intergenic
1164806086 19:31118180-31118202 AAAGAAATGCAGATGGGAGAAGG + Intergenic
1164885469 19:31774835-31774857 ACAGAAAGGAAGACAGGTGAGGG - Intergenic
1166855121 19:45779534-45779556 ATAGTGAGACAGAGTGGAGACGG + Intronic
1166913229 19:46176195-46176217 AAAGAAAAGAAAACTGGAGAAGG + Intergenic
1167529971 19:50009062-50009084 ATATAGAGGCAGACTGGAGGGGG + Intronic
1167680224 19:50915340-50915362 AGAGAGAGACAGACAGGAGAGGG + Intergenic
1167824671 19:51961341-51961363 ATGGAAGGCCAGACTGGTGAGGG + Intergenic
1168637058 19:58004391-58004413 AGAGAAAGAGAGGCTGGAGAAGG + Intronic
925318554 2:2943417-2943439 ATATAAAGGCAGGCTGGACGCGG + Intergenic
925508015 2:4590990-4591012 TTAGAAAGGGAGCCTGAAGATGG + Intergenic
925888396 2:8412957-8412979 CTTGAGAGGCAGGCTGGAGAAGG + Intergenic
926062965 2:9815575-9815597 AGAGAGAGGGAGACTCGAGACGG - Intergenic
926384946 2:12326866-12326888 CTAGAAGGGCAGACAGGGGAGGG + Intergenic
927240256 2:20914728-20914750 AGAGAAAGGCAGGCTGGAAGTGG + Intergenic
927278038 2:21278488-21278510 ATAGAAAGGCAGAAAGCAGAAGG - Intergenic
928054858 2:28042612-28042634 AGGGAAAGGCTGACTGGTGAGGG + Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928218472 2:29382280-29382302 ATAGAAAAGCAGACAGGAACGGG + Intronic
928379046 2:30802528-30802550 AGAGAAAGGCAGGCTGGGGGGGG + Intronic
928534347 2:32225711-32225733 ACAGACAGGCAGACTGGACATGG + Intronic
929751510 2:44719069-44719091 ATATAAGGGCAGACTGCAGAAGG - Intronic
930086102 2:47498354-47498376 ATAGTAAGGCAGACTACACAAGG - Intronic
932577806 2:72972390-72972412 ATAGGAAGCAAGAATGGAGAAGG - Intronic
933018009 2:77155406-77155428 ATATAAATGCAGACTGGATTAGG - Intronic
933636799 2:84717132-84717154 ATAGAAAGGAAGACAGAAGGAGG - Intronic
933729293 2:85445113-85445135 AAAGGAAGGGAGACCGGAGAAGG - Intergenic
934676064 2:96250423-96250445 ACAGAAAGGCAGAGTGAAGTGGG - Exonic
935419079 2:102848259-102848281 GTAGAAAGACAGGCAGGAGAGGG - Intergenic
936236695 2:110748286-110748308 GGAGAAAGGAAGGCTGGAGAGGG + Intronic
938860423 2:135362432-135362454 AGAGGAAGGCAGAAAGGAGATGG + Intronic
939585789 2:144004023-144004045 GGAGAAAGGAACACTGGAGAGGG - Intronic
940296750 2:152133923-152133945 ATAGAAGGGAAGAGTGTAGAAGG - Intronic
941573126 2:167196352-167196374 AAAAAAAGGAAGACTGGGGATGG + Intronic
942553269 2:177143852-177143874 AAAAAAAGGAAGACTGGAGAGGG + Intergenic
943800628 2:192053262-192053284 GAAGAAAGTCACACTGGAGATGG - Intronic
944667787 2:201971500-201971522 TCAGAAATGCAGACAGGAGATGG - Intergenic
945402100 2:209395788-209395810 ACAGAAAGTAACACTGGAGAAGG + Intergenic
946061574 2:216946297-216946319 AAAGAGAGGAAGACGGGAGAAGG - Intergenic
946544718 2:220726033-220726055 ATAGCAAAGCAGTGTGGAGAGGG + Intergenic
946830851 2:223726696-223726718 TGTGAAAGGCAGACTGGAAAAGG - Intergenic
946919644 2:224565415-224565437 GTAGAAAGGGAGGCAGGAGAGGG + Intronic
947339019 2:229117494-229117516 AGAGAAAGGAAGGATGGAGAAGG - Intronic
947385174 2:229584305-229584327 ATATATAGTCAGACAGGAGAAGG + Intronic
947730042 2:232422952-232422974 CTGGAAAGGCAGTCTGCAGAGGG - Intergenic
948315479 2:237025450-237025472 ATAGCAATGCAGAGGGGAGAGGG + Intergenic
949016950 2:241718957-241718979 ATATAAAGGAAGCGTGGAGAGGG + Intronic
1168799858 20:637471-637493 AGAGAAGGGCAGCCTGGGGAGGG - Intergenic
1168928460 20:1601843-1601865 AAAGGAAGGCAGACTGGCTAGGG + Intronic
1169000016 20:2161930-2161952 ATAGATGGGCAGGCTGCAGATGG + Intronic
1170105463 20:12750551-12750573 GCAGAAAGGGAGACTGGAAAGGG - Intergenic
1170157350 20:13280652-13280674 AAAGAAAGGGAGCCTGGAGAAGG + Intronic
1170373418 20:15674292-15674314 ATAGAAGGCCTCACTGGAGAGGG + Intronic
1170735089 20:19007468-19007490 GTAGAAATGTAGACTGAAGAAGG + Intergenic
1170921402 20:20683130-20683152 ACAGAATGGCATACTGGGGATGG - Intronic
1170959984 20:21016647-21016669 AGAGAAAAGCAGGCTGCAGATGG + Intergenic
1172753548 20:37268012-37268034 AGAGAAAGGCAGACTTTAAAAGG + Intergenic
1173208218 20:41011443-41011465 ACAGACAGACAGACTGCAGATGG + Intergenic
1173254901 20:41387306-41387328 ATAGACAGGCAGCTTGGGGAGGG + Intergenic
1173426933 20:42951354-42951376 ATAGATGGACAGACAGGAGAGGG + Intronic
1173756694 20:45522832-45522854 ATAGAAAGGATGCCAGGAGAAGG + Intergenic
1173958052 20:47049872-47049894 AGAGAAAGACAGACTGGTGGCGG - Intronic
1175691355 20:61068088-61068110 AAAGAAAGGGAGGCTGTAGAGGG - Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1178861437 21:36292902-36292924 AAAGAAAAGCAGGCTGGACACGG - Intronic
1179022797 21:37655559-37655581 ATAGGAAGGTAGAATGGACAAGG + Intronic
1180955165 22:19738225-19738247 GTAGAAGGGGAGACTGGAGGAGG - Intergenic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1181840964 22:25660366-25660388 AAAGGCAGGCAGACTGGGGAAGG - Intronic
1182863008 22:33577252-33577274 ATAAAAAGGCACATAGGAGAGGG + Intronic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1184309347 22:43631164-43631186 ATCCAGAGGCAGAATGGAGATGG - Intronic
1184491930 22:44814855-44814877 ATACACAGGCACCCTGGAGACGG - Intronic
1184653209 22:45928637-45928659 ATGGAAAGGCAGAAGGGAAATGG - Intronic
1184857037 22:47151944-47151966 ATAGAAGGGCCCACTGCAGAGGG + Intronic
1185075173 22:48679059-48679081 ATGGACAGGGAGACGGGAGAGGG - Intronic
949829419 3:8197885-8197907 AAAAAAAGTCAGCCTGGAGATGG - Intergenic
950028864 3:9838772-9838794 AAAGAATGGCAGACTTAAGAGGG + Intronic
950132796 3:10558831-10558853 AAGGAAAGGAAGACAGGAGAGGG + Intronic
950864516 3:16178574-16178596 CTTGAACCGCAGACTGGAGAGGG - Intronic
951125118 3:18975539-18975561 ATAGAAAGAGAGACTGGGGTAGG - Intergenic
951132093 3:19059542-19059564 ATACAAAGGAAGACTTCAGATGG + Intergenic
951261776 3:20518242-20518264 ATAGAAAAGAAAACTGGATAGGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951441140 3:22725573-22725595 AAAGAAAGGCATAGGGGAGAGGG - Intergenic
951928943 3:27941992-27942014 TTTGAAAGGCACATTGGAGAAGG + Intergenic
952535032 3:34300331-34300353 ATAGAAAGGCAAATTTGTGAAGG + Intergenic
952687478 3:36166850-36166872 ATATAAAGGATGACTTGAGAAGG - Intergenic
953074082 3:39551622-39551644 ATAGAGAGGCAGTCTGGCTATGG - Intergenic
953356992 3:42264600-42264622 ATAGAAAAGCATAATGGAAATGG + Intronic
953571071 3:44072445-44072467 AAAGCAAGGCAGGCGGGAGAAGG + Intergenic
955817913 3:62865547-62865569 TTAGAATGGCAGACAGCAGATGG + Intronic
956126573 3:66016640-66016662 AAAGAAAAGCAGAATGGAGGAGG + Intronic
957720059 3:83983443-83983465 ATAGAAAGGTGGACTCCAGATGG + Intergenic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
960412348 3:117342794-117342816 GTAGAAAGGCCGAATGGAGAAGG - Intergenic
960525725 3:118707546-118707568 ATAGAATGTCAGAATGGAGAGGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
962129153 3:132654059-132654081 ATAGAAAAGCAGATTTGAGGGGG - Intronic
963982666 3:151557362-151557384 ACAGGAAGGAAGACTGGAGTTGG - Intergenic
965744359 3:171908434-171908456 ACAGAAAGGGAAACTGGATAAGG - Intronic
966030669 3:175343539-175343561 AAAGAAATGCAGATTGTAGAAGG - Intronic
966229732 3:177639008-177639030 ACAGAACGGCAGAATGGATAAGG - Intergenic
966428065 3:179802242-179802264 AAAGAAAAGCAGGCTGGACATGG + Intronic
966496015 3:180581647-180581669 ATAGAAAGGTATACTGGGGCAGG - Intergenic
967937017 3:194737152-194737174 AGAGAAAGGCAGGGTGGGGAGGG - Intergenic
969400008 4:6948351-6948373 AAAGAAAGCCAGACATGAGAGGG - Intronic
970198993 4:13582800-13582822 ATAGAAAGGCAAACTTGTGTGGG - Intronic
971215189 4:24656098-24656120 ATAAAAAGGAAGACTGCAGATGG + Intergenic
973550414 4:52029635-52029657 AAAGAAATGCAAACAGGAGAGGG - Intronic
974078372 4:57188607-57188629 ATAGAAAGTGAGGGTGGAGAAGG - Intergenic
975266603 4:72376449-72376471 GTAGAAAGGTAAAATGGAGAAGG + Intronic
975859677 4:78663504-78663526 AAAGAAAGGCAAAAGGGAGAGGG - Intergenic
976620757 4:87125063-87125085 CAAGAAAATCAGACTGGAGAAGG + Exonic
976787889 4:88843154-88843176 ATTGAAAGGTAGACTCGAAAAGG - Intronic
977789072 4:101076544-101076566 ATGGAAACGCAGACTGGAGTGGG + Intronic
978163062 4:105572571-105572593 ATAGAAACGGAAAGTGGAGATGG - Intronic
980046733 4:127997541-127997563 GAAGAGAGGCAGACTGAAGAGGG - Intronic
981537850 4:145818879-145818901 ATTGATAGGCAGACCAGAGAAGG + Intronic
981871817 4:149496114-149496136 AAAGAGAGTCAGACTTGAGAGGG + Intergenic
982072376 4:151706567-151706589 ATATGAAGGCAGACTAAAGATGG - Intronic
982166473 4:152617990-152618012 AAACAGAGGCAGACTGGAAAGGG - Intergenic
982757841 4:159245298-159245320 TGAGAAAGGAAGATTGGAGATGG + Intronic
983295603 4:165864364-165864386 ATAGAAACTCAGACTGGGCAAGG + Intergenic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983513923 4:168637268-168637290 AGAGAAGGGAAGACTGGAGTGGG - Intronic
983773909 4:171583128-171583150 AGAGAAATACAGACTGAAGATGG + Intergenic
985362471 4:189190264-189190286 ACAGAAAGGCAGAGTGGAATGGG + Intergenic
985475887 5:78771-78793 AGCGCAAGGCAGCCTGGAGATGG - Intergenic
985968176 5:3353505-3353527 AGAGAAAGGGAAACTGGAGTGGG + Intergenic
986174510 5:5340616-5340638 TAAGAAAGGAAGACTGGAGAGGG - Intergenic
986231237 5:5866473-5866495 ATAGAAAGGCACACTGGGCTGGG - Intergenic
986605376 5:9517800-9517822 ACAGGAAAGCAGACTGGAGAGGG - Intronic
987617197 5:20291588-20291610 ATAGAAAGGCACATTCTAGAAGG + Intronic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988231869 5:28489972-28489994 ATAGAAAGGGAGAAGGGAAAGGG + Intergenic
988244476 5:28661596-28661618 AAAGAAAGGCAGGCAGGCGAAGG + Intergenic
989286960 5:39711995-39712017 ATAGAAACAGAGACTGGAGATGG - Intergenic
990174451 5:53091580-53091602 AGAGAAAGTCAGGCTGTAGAGGG - Exonic
990323890 5:54655599-54655621 ATAGATAGGTAGACATGAGAGGG - Intergenic
990507059 5:56455503-56455525 ATGGACAGGAAGCCTGGAGATGG - Intergenic
990566618 5:57036212-57036234 AGAGAAAGGCAGACTAGGGTAGG + Intergenic
990704960 5:58517356-58517378 ACAGAATGGCAGGCTGGATAAGG + Intergenic
991200579 5:63986977-63986999 AAGGAAAGGCACACTGGAAAAGG + Intergenic
991261613 5:64674700-64674722 ATGTAAAGGCAGACTGAATAAGG + Intergenic
991472001 5:66978972-66978994 GAAGAAAGGCAGGCTTGAGAAGG + Intronic
991642954 5:68772788-68772810 ATAGAAAGGCCTACTGCATATGG - Intergenic
992381829 5:76245111-76245133 ATAGAAGGGCAAACTGAAGATGG - Intronic
992478839 5:77130121-77130143 ATATAATGGCAAACTGGAGTGGG + Intergenic
992877312 5:81069721-81069743 ATAGAAAGACAGGCTAGAGAGGG + Intronic
993354189 5:86885315-86885337 TTAGGAAGGAAGAATGGAGAGGG + Intergenic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994696963 5:103084618-103084640 CTAGACTGGCAGACTGGTGAAGG - Intergenic
996651237 5:125879547-125879569 AGAGACAGGAAGACAGGAGAAGG - Intergenic
996870920 5:128192545-128192567 TTAGAAAGGCAAACCAGAGAAGG - Intergenic
996916699 5:128720815-128720837 AGACAAAGGGAGCCTGGAGAAGG - Intronic
997047584 5:130337410-130337432 TTGGAAAGGCAGACTGGGAAAGG + Intergenic
997273931 5:132566561-132566583 ATAGGAAGGCAGCCTGGACAAGG - Intronic
997406768 5:133655191-133655213 AGAGAAAGGCTGATAGGAGAAGG - Intergenic
998166111 5:139845016-139845038 TTTGAGAGGCAGAGTGGAGAAGG + Intergenic
998342899 5:141433344-141433366 ATAGATAGGCAGACAGTAGGTGG - Intronic
998539915 5:142970843-142970865 CTAGAAAGGCTTTCTGGAGAAGG + Intronic
998809356 5:145950526-145950548 ATAGAGAGGGAAACAGGAGAAGG + Intronic
999073001 5:148767630-148767652 ATAGTAAAGAAGACTGGAGTGGG + Intergenic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999190352 5:149742480-149742502 ACAGAAGGGCAGACTGGCTAAGG + Intronic
999438533 5:151582914-151582936 ACAGAAGAGCAGACGGGAGAGGG + Intergenic
1001016226 5:168143728-168143750 GTAGAAAGGCTGAAAGGAGAAGG + Intronic
1001469628 5:172002013-172002035 ATACAAAGGAAGACTGGAATTGG + Intronic
1001614261 5:173029864-173029886 GAAGGAAGGCAGACTGGGGAGGG - Intronic
1001860246 5:175047942-175047964 ACAGAAGGGCAGCATGGAGAGGG + Intergenic
1003498741 6:6687041-6687063 CTGGAAAGGCGGACTGGAGGGGG - Intergenic
1004002396 6:11607243-11607265 AGAGGAAGCAAGACTGGAGAAGG + Intergenic
1004685270 6:17937203-17937225 ATGGAAAGGAAGTCTGGAGTCGG + Intronic
1004764486 6:18710191-18710213 ATAAGAAAGAAGACTGGAGAAGG - Intergenic
1005138514 6:22599732-22599754 ATAGCAAGGCAGGAAGGAGATGG + Intergenic
1006318311 6:33304161-33304183 GAAGAAAGGCAGACAGGAAAAGG + Exonic
1006579531 6:35068835-35068857 AGAGACAGGCAGACTGAACATGG + Intronic
1007409580 6:41654051-41654073 CTAGGAAAGGAGACTGGAGAGGG - Exonic
1008458215 6:51736769-51736791 ATAAAATGGGAGATTGGAGAGGG - Intronic
1008593166 6:53013883-53013905 ACAGAAAGGCATCCTGGAAAAGG - Exonic
1008733309 6:54509962-54509984 AGACAAAGGCAGACTGGCTAGGG - Intergenic
1009244796 6:61223489-61223511 ACAGAAAGCAAGATTGGAGATGG - Intergenic
1010116801 6:72322283-72322305 ACAGAATGGCAGACCTGAGATGG - Intronic
1010252781 6:73725389-73725411 GTAGAAAGGCTGAAAGGAGAAGG + Intronic
1010776903 6:79897417-79897439 ATAGACAGGCAGTGTTGAGAGGG + Intergenic
1011027475 6:82885080-82885102 AGAGCAAAGCTGACTGGAGATGG + Intergenic
1011882784 6:92051680-92051702 ATAGAAATGCAGACTATAAAAGG + Intergenic
1012016499 6:93859019-93859041 ATAGAAAGGCTCCCTTGAGATGG + Intergenic
1012902536 6:105022788-105022810 AGAAACAGGAAGACTGGAGAAGG + Intronic
1013752222 6:113420566-113420588 ATAGGAAGGCAGACACGACATGG + Intergenic
1013813878 6:114074552-114074574 GTAAAAAGGCAGAATAGAGAGGG - Intronic
1014736827 6:125103581-125103603 ATAAAAATGCATACTGTAGAAGG - Intergenic
1016060400 6:139623852-139623874 ATAAAAAGCCATACTGGAGGTGG + Intergenic
1016669543 6:146687281-146687303 AAAGAAAGGCAGGCGTGAGAAGG - Intronic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017856138 6:158350722-158350744 AAAGAAAGGAAGAGGGGAGAGGG + Intronic
1019048371 6:169165136-169165158 ATATATAGGCAGATTTGAGAGGG - Intergenic
1019580901 7:1762046-1762068 ATAGAAAGGAATAATGAAGAGGG - Intergenic
1020382666 7:7564091-7564113 AAAGAAATACAGACTGGAAATGG - Intergenic
1020508268 7:9020179-9020201 ATGGAACGGGAGACTGGAGGGGG + Intergenic
1021524301 7:21569481-21569503 AAAGAAAGGAAGAGAGGAGAAGG - Intronic
1021591212 7:22264746-22264768 ACAGATAGGGAGGCTGGAGAAGG - Intronic
1021918844 7:25463261-25463283 ATAGCAAAGAAGACTGGAGATGG + Intergenic
1022235220 7:28454438-28454460 ATAGGACGGCAGACAGCAGAAGG - Intronic
1022673335 7:32476383-32476405 ATTTAAAGGCAGCCTGGGGATGG - Intergenic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1022947186 7:35298741-35298763 AAGAAAAGGCAGACTGGAGAAGG - Intergenic
1023152838 7:37218073-37218095 ATAGAAAGGCCCACTGGTGGTGG + Intronic
1023633455 7:42185336-42185358 ATAAGAAAGCAGCCTGGAGAAGG - Intronic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1026500221 7:70937468-70937490 ATACAATGGCAGCTTGGAGAAGG + Intergenic
1026899528 7:74029240-74029262 ATGGAAAGGCGGGCTGGAGAAGG + Intronic
1027124439 7:75546285-75546307 ATAGAAAGATGGACTGGACAAGG - Intronic
1027480114 7:78685142-78685164 AAAGAAAATCAGACAGGAGAAGG - Intronic
1028446786 7:90933606-90933628 ATAGAATGGCAGACCAGAAAAGG + Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1030091178 7:105860553-105860575 TTAAAAAGTCAGTCTGGAGATGG - Intronic
1032248726 7:130234597-130234619 AAAGAAAGGCAGATTACAGAAGG - Intergenic
1032877774 7:136056179-136056201 ATAGAAAGACAGACTTAAGAGGG + Intergenic
1034239267 7:149597275-149597297 CTAGAAAGGCAGTCTGGCTACGG + Intergenic
1034369839 7:150585253-150585275 ATGGAATGAGAGACTGGAGAAGG + Intergenic
1035447723 7:158954248-158954270 TTATAAAGACATACTGGAGACGG - Intronic
1035623022 8:1048785-1048807 GAAGAAAGGCACACAGGAGAGGG - Intergenic
1035866521 8:3089098-3089120 ATACAAAGAGAGACTGGAGCAGG + Intronic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1036567458 8:9949671-9949693 AAAGACAGACAGACGGGAGAAGG - Intergenic
1037533571 8:19803603-19803625 ATTTAAAGGCAGACTAGAGCAGG + Intergenic
1037590359 8:20306732-20306754 ATGAGAAGGCAGAGTGGAGAAGG + Intergenic
1038833587 8:31092746-31092768 ATGGAAGGACAGACTGGGGAGGG - Intronic
1038854379 8:31315093-31315115 ATAGAAAAGCAAACTGAAGCAGG - Intergenic
1038890186 8:31712908-31712930 ATAGACAGACAGATTGAAGAAGG - Intronic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1039294301 8:36132503-36132525 AGAAGAAGGCAGACTGGATAGGG - Intergenic
1039438542 8:37578484-37578506 TTTGAAAGGGAGAGTGGAGAGGG - Intergenic
1040009471 8:42649254-42649276 GTGGAAAGGGGGACTGGAGAGGG - Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1040956948 8:52989254-52989276 ACAACAAGGCAGACTGGAGGAGG + Intergenic
1042348385 8:67750784-67750806 ACAGAAAGGCTGAATGGAGATGG - Intergenic
1042813298 8:72849986-72850008 ATACAAAGACAGACTAGATATGG - Intronic
1043288882 8:78570875-78570897 ATAGAAGGCAATACTGGAGATGG - Intronic
1043374432 8:79632460-79632482 AGAGAAAGGAAAAGTGGAGAGGG + Intronic
1043654577 8:82646150-82646172 AGTGAAAGGAAGGCTGGAGAAGG + Intergenic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1043953599 8:86337380-86337402 ATAGGAAGGTAAACAGGAGAGGG + Intergenic
1044449486 8:92317524-92317546 TTAGAAATGGAGCCTGGAGATGG + Intergenic
1044850666 8:96424308-96424330 AAAGAAAGCCAGATTGGAGGGGG + Intergenic
1045364202 8:101460721-101460743 TTAGAAAGGAAGACTAGAGGTGG - Intergenic
1047395202 8:124491354-124491376 AAGCAAAGGCAGACTGCAGAAGG - Intronic
1047520450 8:125591796-125591818 ATAGGAAGGCAAACAGGACATGG - Intergenic
1047895621 8:129363328-129363350 ATAGAAATGCAGCCTTTAGAGGG - Intergenic
1048507165 8:135032114-135032136 AGACAGAGACAGACTGGAGAAGG - Intergenic
1051630470 9:19135975-19135997 CTAGGAAGGCAGACTGGAAAGGG - Intronic
1052199235 9:25757663-25757685 ATAGGAAGGCAGAGTGGCTAGGG + Intergenic
1052449115 9:28604073-28604095 ATAGAAAGTCATACTGTAAAAGG - Intronic
1052882301 9:33609662-33609684 ATACAAAAGCAGACTTGAAAAGG + Intergenic
1053181798 9:35978448-35978470 ACAGAAAGGCAGGCAGGAAAAGG - Intergenic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1053494019 9:38536079-38536101 ATACAAAAGCAGACTTGAAAAGG - Intergenic
1054916322 9:70498167-70498189 CAAGAAAGGCAAACTGGGGAGGG + Intergenic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055245946 9:74242582-74242604 ATAGAAAGGCAGCCTATAGATGG - Intergenic
1055595099 9:77857687-77857709 AGAGAAAGGAAGACAGGAAAGGG + Intronic
1056768210 9:89458111-89458133 ATAAAAAGGCAGGCTGTGGAGGG + Intronic
1057367987 9:94442054-94442076 ATACAGAGGAAGACGGGAGAAGG - Intronic
1057852312 9:98575118-98575140 AGAGACAGGCAGAGTGGAGTGGG + Intronic
1058249221 9:102669954-102669976 AAAGAAAGGAAGAGAGGAGATGG - Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1061615270 9:131775001-131775023 ACAGAACGGCAGCCAGGAGAAGG + Intergenic
1061754655 9:132804180-132804202 ATAGAAATGCAGGCAGCAGAGGG + Intronic
1186179904 X:6963297-6963319 ACAGAAAGGGAGGCTGGAAATGG + Intergenic
1186348336 X:8717633-8717655 ATAGAAAGGGAGAGGGAAGAGGG + Intronic
1186879817 X:13853760-13853782 TTAGAAAGGCAGGCTGGTCATGG + Intronic
1187558210 X:20373332-20373354 ATAGAAGGAAAGTCTGGAGATGG - Intergenic
1187668202 X:21639619-21639641 ATACAATGTCAGACTGGTGATGG + Intronic
1187973711 X:24683988-24684010 TGAGACAGGAAGACTGGAGAGGG - Intergenic
1188032162 X:25276236-25276258 ATAGAAAGGAAGATAGGAGTTGG + Intergenic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188974758 X:36659863-36659885 ACAGAAAGACACACTGAAGAGGG + Intergenic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1191922949 X:66277171-66277193 AGAGAAAGGCAGACTGGCTAGGG + Intergenic
1192106824 X:68325864-68325886 ATGGACACGGAGACTGGAGATGG - Intronic
1192395075 X:70772169-70772191 CTAGACAGGCAGACTGGTAAAGG + Intronic
1192425355 X:71070082-71070104 TTAGAAAGGTAGACTGGCTAGGG + Intronic
1197729124 X:129795205-129795227 ATAGAAAAGATAACTGGAGACGG - Intergenic
1198084805 X:133271926-133271948 AAAGAAAGTCAGACTGGGCACGG + Intergenic
1198221322 X:134605100-134605122 GCAGAAAGCCAGGCTGGAGAGGG - Intronic
1198663396 X:138996036-138996058 CTTGAAAAGCAGTCTGGAGAGGG + Intronic
1201522519 Y:14891611-14891633 ATAGAAAGAGAGAAAGGAGAAGG - Intergenic
1201552404 Y:15231659-15231681 AGAGAAATGCAGAATGGAGTTGG - Intergenic