ID: 1181826629

View in Genome Browser
Species Human (GRCh38)
Location 22:25521693-25521715
Sequence GCGAACAAGAGGAGCAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181826624_1181826629 10 Left 1181826624 22:25521660-25521682 CCAATGTGGAAGCTGGATTGAAG No data
Right 1181826629 22:25521693-25521715 GCGAACAAGAGGAGCAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181826629 Original CRISPR GCGAACAAGAGGAGCAATAT GGG Intergenic
No off target data available for this crispr