ID: 1181827378

View in Genome Browser
Species Human (GRCh38)
Location 22:25528706-25528728
Sequence ATTTTGTGTTGGAGAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181827375_1181827378 10 Left 1181827375 22:25528673-25528695 CCATGCACACTGGAGAAGTAGCA No data
Right 1181827378 22:25528706-25528728 ATTTTGTGTTGGAGAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181827378 Original CRISPR ATTTTGTGTTGGAGAATCAA AGG Intergenic
No off target data available for this crispr