ID: 1181831749

View in Genome Browser
Species Human (GRCh38)
Location 22:25565244-25565266
Sequence CACCCGCCCCGGGGCAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181831749_1181831758 1 Left 1181831749 22:25565244-25565266 CCTCCGCTGCCCCGGGGCGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1181831758 22:25565268-25565290 CACAGCGGAGCGGGCGATGCGGG 0: 2
1: 0
2: 0
3: 6
4: 106
1181831749_1181831760 6 Left 1181831749 22:25565244-25565266 CCTCCGCTGCCCCGGGGCGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1181831760 22:25565273-25565295 CGGAGCGGGCGATGCGGGGCCGG 0: 2
1: 0
2: 4
3: 29
4: 342
1181831749_1181831755 -9 Left 1181831749 22:25565244-25565266 CCTCCGCTGCCCCGGGGCGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1181831755 22:25565258-25565280 GGGCGGGTGACACAGCGGAGCGG 0: 1
1: 1
2: 0
3: 5
4: 176
1181831749_1181831757 0 Left 1181831749 22:25565244-25565266 CCTCCGCTGCCCCGGGGCGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1181831757 22:25565267-25565289 ACACAGCGGAGCGGGCGATGCGG 0: 2
1: 0
2: 0
3: 9
4: 88
1181831749_1181831756 -8 Left 1181831749 22:25565244-25565266 CCTCCGCTGCCCCGGGGCGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1181831756 22:25565259-25565281 GGCGGGTGACACAGCGGAGCGGG 0: 1
1: 1
2: 0
3: 11
4: 136
1181831749_1181831759 2 Left 1181831749 22:25565244-25565266 CCTCCGCTGCCCCGGGGCGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1181831759 22:25565269-25565291 ACAGCGGAGCGGGCGATGCGGGG 0: 2
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181831749 Original CRISPR CACCCGCCCCGGGGCAGCGG AGG (reversed) Intronic