ID: 1181831771

View in Genome Browser
Species Human (GRCh38)
Location 22:25565318-25565340
Sequence ATGGGGCATCGGAGGGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 2, 2: 1, 3: 13, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181831761_1181831771 3 Left 1181831761 22:25565292-25565314 CCGGCCTCGTCGTTCCAGTCTCT 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1181831771 22:25565318-25565340 ATGGGGCATCGGAGGGCCGGTGG 0: 1
1: 2
2: 1
3: 13
4: 136
1181831762_1181831771 -1 Left 1181831762 22:25565296-25565318 CCTCGTCGTTCCAGTCTCTGAAA 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1181831771 22:25565318-25565340 ATGGGGCATCGGAGGGCCGGTGG 0: 1
1: 2
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181831771 Original CRISPR ATGGGGCATCGGAGGGCCGG TGG Intronic
900154208 1:1197609-1197631 ATGCGGCATGGGTGGCCCGGAGG - Exonic
901473345 1:9472808-9472830 ATGGGGAAACTGAGGCCCGGAGG - Intergenic
902408405 1:16199097-16199119 ATGGGGCTTGGGTGGGCAGGAGG - Intronic
903928865 1:26850776-26850798 ATGGGGCATTGTGGGGCCGGGGG + Intronic
904643077 1:31944975-31944997 GTGGGGCAGCGGAGGCCTGGCGG + Intergenic
904752473 1:32749504-32749526 ATGGGGCAGCTGAGGCCCGGAGG + Intronic
905443814 1:38011721-38011743 ATGGGGCCTCTGGGGGCTGGTGG + Intronic
908799421 1:67864170-67864192 ATGGGGGTTGGGAGGGGCGGTGG + Intergenic
915163143 1:153933532-153933554 ATGGGGCTGCGGCGGGCTGGGGG + Exonic
923706800 1:236350796-236350818 ATGGGGCAGGGGAGGGCTGGAGG - Intronic
1063188323 10:3670102-3670124 GTGGGGCATCTGAAGGCCAGTGG - Intergenic
1065529345 10:26653107-26653129 TTGGGGCCTTGGGGGGCCGGGGG - Intergenic
1069214774 10:65805343-65805365 ATGGGGCATTGGAGGGTGGTAGG + Intergenic
1071434584 10:85635407-85635429 AGGGGGCAGGGGAGGGCAGGGGG - Intronic
1076379599 10:130015885-130015907 GTGGGGCCTCGGGGGGACGGTGG - Intergenic
1076884830 10:133257556-133257578 CTGGGGCAGAGGAGGGGCGGGGG - Intergenic
1077372449 11:2189673-2189695 ATGGGGCTGCGGGGGGCTGGCGG + Intergenic
1078227465 11:9405466-9405488 ATGAGGCTACTGAGGGCCGGGGG - Intronic
1078594561 11:12674877-12674899 ACGGGGCAGCGGGGGGCCGGCGG + Intronic
1080517755 11:33039662-33039684 ATGCGGCCTCGGAGGGGCAGAGG + Exonic
1082166459 11:48955769-48955791 ATGGGGCATCTGCTGGGCGGAGG + Intergenic
1084515896 11:69637842-69637864 CTGGGGCACGGGAGGGGCGGTGG + Intergenic
1088823308 11:113474734-113474756 CCGCGGCATCGGAGGGCGGGAGG - Intronic
1090359272 11:126161275-126161297 AGGGGGCATCTGAGGACAGGAGG + Intergenic
1091360190 11:134973366-134973388 ATGGGGCATCCCAGGGCCTTCGG + Intergenic
1091384058 12:80994-81016 TTGGGGCATGGGAGGGTAGGAGG + Intronic
1092258926 12:6942078-6942100 ACGGGGCAGGGGAGGGGCGGCGG - Exonic
1101115875 12:101530762-101530784 GTGGGGAAGAGGAGGGCCGGTGG + Intergenic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1104355887 12:128086935-128086957 AAGGGGCAGCGGCGGGGCGGGGG + Intergenic
1105829317 13:24150000-24150022 GTGGGGCATGGGAGAGTCGGGGG + Intronic
1107466791 13:40658426-40658448 ATGAGCCATCTGAGGGCAGGGGG + Intronic
1108589586 13:51901429-51901451 GTGAGGCATGGGAGGGCGGGTGG - Intergenic
1113389815 13:109884814-109884836 TTGGGGCCTGGGAGGGACGGTGG - Intergenic
1113954133 13:114087760-114087782 AGAGGGCCTTGGAGGGCCGGAGG + Intronic
1114652567 14:24295469-24295491 ATGGGGAATGGGTGGGCAGGAGG + Intronic
1119382837 14:74239787-74239809 ATGGGGCTTCTGGGGCCCGGGGG + Exonic
1119645076 14:76342045-76342067 TTGGGACATGGGAGGGCAGGTGG + Intronic
1122262644 14:100531926-100531948 GTGGGGCATCGGTGGGGCCGGGG - Intergenic
1128309739 15:66622481-66622503 AGGGGGCATCTTAGGGCGGGGGG - Intronic
1128818284 15:70630004-70630026 ATGGGGAAACGGAGGTGCGGTGG - Intergenic
1129822881 15:78616686-78616708 ATGGAGCAGAGGAGGGCCCGGGG - Intronic
1130064514 15:80593088-80593110 ATGGGTCATCTGAGGCCCAGAGG + Intronic
1131098883 15:89672799-89672821 AGGGGGCCTGGCAGGGCCGGAGG - Intronic
1131599283 15:93830211-93830233 ATGGGGTATTGGAGGACAGGAGG - Intergenic
1132314467 15:100879956-100879978 ATGGGGCGCGGCAGGGCCGGCGG - Exonic
1132397959 15:101488732-101488754 TTGGGACAGCGCAGGGCCGGGGG - Intronic
1136245610 16:28974301-28974323 ATGGAGGATTGGAGGGACGGAGG - Intronic
1137053848 16:35734339-35734361 ATGGGGCACCGCAGGGGTGGAGG - Intergenic
1138165636 16:54799115-54799137 AAGGGGCATAGGTGGGCCTGAGG + Intergenic
1141320668 16:83005495-83005517 ATTGGGCATCTGAAGGCCTGAGG - Intronic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142888611 17:2928809-2928831 ATGGGGAGTCGGAGGGGTGGGGG + Intronic
1142994052 17:3750654-3750676 ATGGAGCCTCGAAGGGCAGGTGG + Intronic
1143562647 17:7704937-7704959 TTGGGCGATCGGAGGGCAGGAGG + Intergenic
1143614628 17:8042515-8042537 ATAGGGCATCTGAGGCCCAGGGG - Intronic
1143628086 17:8122307-8122329 GTGGGGCAGCGGAGGGAGGGAGG - Intronic
1145899151 17:28478688-28478710 ATGGGGAACAGGAGGGCCTGGGG + Intronic
1146062490 17:29614509-29614531 GTGGGGCAGGGGAGAGCCGGGGG - Exonic
1146487519 17:33255583-33255605 AGGGGGGATCGGAGGGACGGGGG + Intronic
1146695672 17:34907661-34907683 ATGGGGCAGCGGCTGGGCGGGGG - Intergenic
1146731306 17:35195293-35195315 ATGGGGCAGCTGCGGGGCGGAGG + Intergenic
1147614954 17:41822200-41822222 CTGGGGCAGGGGAGAGCCGGGGG - Intronic
1147845083 17:43399245-43399267 TTGGGGCTGCGGAGGGCGGGTGG + Intronic
1148677819 17:49455326-49455348 ATGGGGCATGGGGGGGATGGAGG + Intronic
1148874950 17:50681558-50681580 ATGGGGCAGTGGAGTGCAGGGGG - Intronic
1150136125 17:62696292-62696314 AGGGAGCAGCGGAGGGACGGAGG + Intergenic
1151589403 17:75033692-75033714 ATGGGGCGTCCCAGTGCCGGGGG + Intronic
1151783890 17:76265782-76265804 GTGGGGCAGCCGAGGGTCGGGGG + Intronic
1152192508 17:78897160-78897182 CTGTGGCATCGGGGGGCGGGGGG + Intronic
1157285603 18:46375143-46375165 CTGGGGCCTCTGAGGGCGGGGGG - Intronic
1159854115 18:73563957-73563979 ATGGGGCATCAGAGAGGCTGTGG - Intergenic
1160760357 19:781086-781108 GTGGGGCCCCGGAGGGGCGGGGG + Intergenic
1163583844 19:18153626-18153648 ATGGGGTGCGGGAGGGCCGGGGG + Intronic
1165430410 19:35768666-35768688 ATGGGGCAGCGGAGGATGGGGGG - Exonic
1167453398 19:49585259-49585281 GTGGGGCATCGGAGGCCCGGAGG - Intronic
1168512180 19:56981601-56981623 ATGGGACAACTGAGGGCTGGTGG - Intergenic
1168694468 19:58396772-58396794 CTGGGGCCGCGGGGGGCCGGAGG - Exonic
925025128 2:601468-601490 AGGGGGCAGCCGGGGGCCGGGGG + Intergenic
925450950 2:3968764-3968786 AGGGGGCATCGGAAGGGTGGAGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
941779289 2:169426941-169426963 CTGGGGCATGGGAGTGCAGGGGG + Intergenic
945530849 2:210950979-210951001 ATGGGGCGGCGGCGGGGCGGAGG - Intergenic
946280474 2:218662485-218662507 ATGGAGCATGGGATGGCAGGAGG - Intronic
947187369 2:227467209-227467231 AGGGGGCGGCGGAGGGCAGGTGG + Intergenic
947534680 2:230933341-230933363 AAGGGCCAACGGAGGGCAGGTGG - Intronic
1170052285 20:12159110-12159132 ATGTGGGATGGAAGGGCCGGTGG + Intergenic
1170292435 20:14785571-14785593 CTGGGGCATCAGAGGAGCGGGGG - Intronic
1170557065 20:17523369-17523391 AGAGGGCCTCGGAGGGCCTGAGG + Intronic
1173548299 20:43915402-43915424 GTGGGGCATCGGAGCGTCTGTGG - Intronic
1175784914 20:61706297-61706319 AGGGGGCTTCAGAGGGCCGGGGG + Intronic
1176115751 20:63431173-63431195 ATGGGGCCACGCAGGGCAGGGGG + Intronic
1180673837 22:17573496-17573518 ATGGGGCACCTGGGGGCTGGAGG + Intronic
1181602380 22:23960198-23960220 ATGGGGTATGGGAGGGCCACTGG + Intronic
1181606131 22:23981109-23981131 ATGGGGTATGGGAGGGCCATTGG - Intronic
1181793165 22:25283223-25283245 ATGGGGCATCGGATGGCCGGTGG + Intergenic
1181813810 22:25421498-25421520 ATGGGGCATCGGAGGGCGGGTGG + Intergenic
1181831771 22:25565318-25565340 ATGGGGCATCGGAGGGCCGGTGG + Intronic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182792149 22:32961723-32961745 ATTGAACAGCGGAGGGCCGGGGG + Intronic
1183155947 22:36075562-36075584 CTGGGGGATCGGAGGGGCGGGGG - Intergenic
1183540837 22:38428450-38428472 AGTGAGCATAGGAGGGCCGGAGG - Intronic
1184523154 22:45007575-45007597 AGGGGGCAGCGGAGGGAGGGAGG + Intronic
1185337025 22:50275315-50275337 CTGGGGGATCTGAGGGCCTGTGG - Exonic
953032245 3:39186480-39186502 ATGGGGCATCTGAGAGCCTCAGG - Exonic
963009863 3:140759111-140759133 AAGGGGCACCGGAGGGAGGGAGG - Intergenic
968225584 3:196970032-196970054 AGGGGGCAGCGTCGGGCCGGCGG - Intergenic
969685862 4:8673736-8673758 ATGGGCCAACGGAGGCCCAGAGG - Intergenic
969791848 4:9498222-9498244 AGGGGGCTTCGGAAGCCCGGAGG - Intergenic
972380475 4:38514815-38514837 ATGTGGCATTGGAGGGGCGCAGG + Intergenic
985489313 5:169968-169990 ATGGGGCATCCAGGGGCAGGGGG - Intronic
985643482 5:1074392-1074414 ATGGCGCAGCTGGGGGCCGGGGG - Intronic
998071272 5:139199681-139199703 GTGGGGGATCTGAGGGCAGGAGG - Intronic
998808482 5:145941749-145941771 ATGGGGAATTGGAGGACCTGAGG - Intronic
1002170273 5:177370870-177370892 CTCGGGCAGCAGAGGGCCGGAGG - Intronic
1003822751 6:9918212-9918234 ATGGAACATCGGATGGACGGAGG - Intronic
1004538074 6:16522154-16522176 ATGGGGCATCTGAGGCCCAGAGG - Intronic
1010736564 6:79450471-79450493 ATGGGGCAGGGCAGGGCCAGGGG - Intergenic
1018712291 6:166505744-166505766 ACGGGGACTCGGGGGGCCGGTGG - Intronic
1019124083 6:169827694-169827716 ATGGGGAGTGGGCGGGCCGGGGG - Intergenic
1019258556 7:66968-66990 ACTGAGCAGCGGAGGGCCGGTGG + Intergenic
1023987116 7:45103197-45103219 GTGTGGCATGGGAGGGCAGGGGG - Intronic
1025145058 7:56494951-56494973 ATGGGGCATCTGAGGGGCAGTGG - Intergenic
1025728172 7:64087208-64087230 ATGGGGCCTCAGAGGGCCCTGGG + Intronic
1026115090 7:67489275-67489297 GGGTGGCATAGGAGGGCCGGAGG + Intergenic
1028918077 7:96281601-96281623 AAGGGGCATCAGAGGGCCTCTGG + Intronic
1029055132 7:97733149-97733171 CAGGGGGATTGGAGGGCCGGAGG + Intronic
1029730400 7:102434457-102434479 ATGGGGCATGGGAGGCCTGGCGG + Intronic
1036966415 8:13303272-13303294 ATGGGGCATCCTGGGGCCTGTGG + Intronic
1037881930 8:22577824-22577846 ATGGGGAAACTGAGGCCCGGAGG + Intergenic
1039860587 8:41453788-41453810 ATTGGGCATGGGAGGGAGGGAGG - Intergenic
1041552847 8:59119818-59119840 GTGGGGCCGGGGAGGGCCGGGGG - Intergenic
1042524836 8:69753315-69753337 CTGGGGCATGGGAGGCCAGGGGG + Intronic
1044966506 8:97579126-97579148 ATGTGGCATCAGAGGCCAGGTGG - Intergenic
1046717747 8:117585992-117586014 ATGTGGCATAGGAGGGGAGGGGG + Intergenic
1048443777 8:134478454-134478476 ATGTGGCATCGGATGGCCACAGG - Exonic
1049441653 8:142612431-142612453 GTGGGGCATCTGAGAGCTGGCGG - Intronic
1049697291 8:143990455-143990477 ATGGGCCCTCCGCGGGCCGGGGG - Intronic
1057314675 9:93960685-93960707 ATGGGGCAAGGGAGGGCCTGCGG - Intergenic
1057869893 9:98709308-98709330 CTGGCGCAGCGGAGGGCCGGGGG - Intergenic
1058851074 9:109012975-109012997 AGGGGGCATCGCCCGGCCGGGGG + Intronic
1059172914 9:112143480-112143502 ATGTGGCATCGGTGGTCGGGTGG + Exonic
1060300027 9:122369735-122369757 GTGGGGCATTGGAGGGCCCTGGG - Intergenic
1060989335 9:127839174-127839196 ATGGGGCTTCAGGGGGCCGCAGG - Intronic
1062345379 9:136112072-136112094 GTGGGGGATCTGAGGGGCGGTGG - Intergenic
1062566877 9:137167534-137167556 AGGGGGCAGAGGAGGGCGGGCGG - Intronic
1186905174 X:14102876-14102898 GTGGGGGATGGGAGGGCAGGTGG - Intergenic
1189352984 X:40290926-40290948 AGGGGGCATCTGAGGGCACGAGG + Intergenic
1190485145 X:50916484-50916506 ACGGGACACAGGAGGGCCGGGGG - Exonic
1190797753 X:53760307-53760329 ATGGGGGAGCTGAGGGCAGGCGG - Intergenic
1190917403 X:54820907-54820929 ATGGGGGAGCTGAGGGCAGGCGG + Intergenic
1196046365 X:111260259-111260281 ATGGGGCGGCGGGGGGCCGGGGG + Intronic