ID: 1181832002

View in Genome Browser
Species Human (GRCh38)
Location 22:25567408-25567430
Sequence TACCACTGGATGGCAGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181832002 Original CRISPR TACCACTGGATGGCAGTTAG TGG Intronic
901587033 1:10304494-10304516 TAACACTGGAGGTCAGTTAGAGG + Intronic
902809625 1:18880660-18880682 TACCACTGGCTGGAAGTGGGTGG - Intronic
905310356 1:37044684-37044706 TAAAACTGGATGGCAGTGATGGG - Intergenic
906296058 1:44649898-44649920 CAACACTGGATGGACGTTAGGGG - Exonic
906446727 1:45905814-45905836 TACCATTTGATGGGGGTTAGGGG - Intronic
906817006 1:48889597-48889619 TGACACTGGAAGGGAGTTAGTGG + Intronic
908107345 1:60858647-60858669 GACCACAGGCTGGCAGTGAGCGG - Intergenic
909844209 1:80370273-80370295 TTCCACTGGAAGGCCTTTAGGGG - Intergenic
911209742 1:95126728-95126750 TACCAGAGGATGGTAGATAGAGG - Intronic
912650355 1:111433225-111433247 ACCCACTGGATGGCAGGAAGGGG + Intergenic
915052586 1:153091497-153091519 TACCACAGGGTGGCAGTTATGGG + Intergenic
917890294 1:179430952-179430974 AACCAATGGGTGACAGTTAGAGG + Intronic
923046024 1:230356288-230356310 TACCAGTGGAAGGCAGGAAGGGG + Intronic
923611795 1:235502582-235502604 AACTACTGGATGGCAGATAAAGG + Intronic
1088563773 11:111145584-111145606 TACTACTGGATGTCATGTAGTGG + Intergenic
1092346216 12:7716769-7716791 TACCACAGAATGGCAGCTTGTGG - Intronic
1097705569 12:62865304-62865326 TGTCTCTGGATGGCAGTTTGTGG - Intronic
1107055084 13:36094514-36094536 TACCCATGACTGGCAGTTAGTGG - Intronic
1114925489 14:27392230-27392252 TGCCTCTGGAAGGCAGTTAGGGG + Intergenic
1117830749 14:59747156-59747178 TATCACTGGATGGCAATGAATGG - Intronic
1118307166 14:64664559-64664581 TACCACTGGAAGGTCTTTAGGGG + Intergenic
1119734616 14:76973962-76973984 TAGCACTGGACTGCAGTCAGAGG + Intergenic
1122397661 14:101445190-101445212 AACCACTGCATGACAATTAGAGG - Intergenic
1122561951 14:102622030-102622052 TTTCTGTGGATGGCAGTTAGGGG - Intronic
1124957401 15:34368132-34368154 GCCCATTGCATGGCAGTTAGGGG + Intergenic
1131382545 15:91975754-91975776 CACCACTGGGTGGCTGTAAGGGG - Intronic
1132065847 15:98730434-98730456 TACCAATGGGTAGCAGCTAGCGG + Intronic
1132677164 16:1125578-1125600 TAACACTGGATGGCTGGGAGAGG - Intergenic
1135121415 16:19769609-19769631 TACGGCTAGAAGGCAGTTAGGGG + Intronic
1138570906 16:57872407-57872429 TACCACTGCATTCCAGTTTGGGG - Intergenic
1140337253 16:74119337-74119359 GACGACTGGATGGCAGTCTGGGG + Intergenic
1144232030 17:13217134-13217156 ATCAACTGGATGGCAGATAGTGG + Intergenic
1148290918 17:46448375-46448397 TTCCAATGTCTGGCAGTTAGGGG + Intergenic
1148313108 17:46666080-46666102 TTCCAATGTCTGGCAGTTAGGGG + Intronic
1156464710 18:37341497-37341519 TCCCACTGGAAGGCAGTGAGTGG + Intronic
1157193296 18:45599222-45599244 TACTCCTGGATGGGGGTTAGGGG - Intronic
1159887667 18:73924448-73924470 GACCACTGGCTGGCAGGGAGCGG + Intergenic
1163582622 19:18147521-18147543 TCTCACTGGATGACAGTGAGTGG - Exonic
1165693665 19:37884073-37884095 CATCACTGGATGGCACTAAGGGG - Intergenic
926375854 2:12226680-12226702 TCTCACTACATGGCAGTTAGAGG - Intergenic
927994751 2:27476560-27476582 TACCACAGGATTGCATTCAGTGG - Intronic
929375707 2:41284347-41284369 TACCTCTGGGTGGCAGGGAGGGG - Intergenic
930868535 2:56146701-56146723 TACCACTGAAAGGGAGTGAGTGG + Intergenic
931251683 2:60536637-60536659 AATCACTTGAAGGCAGTTAGGGG - Intronic
935243602 2:101199028-101199050 AACCACTGAATTGCATTTAGTGG - Intronic
940376421 2:152963882-152963904 TACCTCTGGGTGGTTGTTAGTGG - Intergenic
941077228 2:161019742-161019764 TACCACTGGATGGCTGTGTGGGG - Intergenic
945965119 2:216178793-216178815 TAGCACTGGCTGCCACTTAGGGG - Intronic
1170591483 20:17775234-17775256 TGCCTCTCGATGGCATTTAGGGG - Intergenic
1177232870 21:18345449-18345471 TACCACTGAATGGCTGGGAGCGG + Intronic
1178410563 21:32360198-32360220 TACCCCTGGAGGGCACTTGGTGG - Intronic
1181685586 22:24525614-24525636 TGCCACTGGAGGGCAGTCATGGG - Intronic
1181832002 22:25567408-25567430 TACCACTGGATGGCAGTTAGTGG + Intronic
949762417 3:7485807-7485829 TGCCACTGCATGGAAGTTAATGG + Intronic
951475287 3:23098886-23098908 TACAACTTCATGGCAGTTTGGGG - Intergenic
954174174 3:48830327-48830349 TACCACTGGAAGGTCTTTAGGGG + Intronic
956962102 3:74415191-74415213 TACCACTGCAGACCAGTTAGGGG + Intronic
960448092 3:117772790-117772812 TAACAATGAATGGCAGTTATGGG - Intergenic
962342286 3:134595749-134595771 TACCACTGGATACCACTTCGTGG + Intergenic
965482769 3:169240742-169240764 TACCACTGGCTGGCATCTAGAGG - Intronic
965898439 3:173608607-173608629 TACCACTGGCTGCTAGTTAGTGG + Intronic
966307700 3:178555629-178555651 TTCCACTGTATTGCAGTTTGTGG + Intronic
966763396 3:183436840-183436862 AACCACAGGATGGGAGTCAGAGG - Intergenic
972098229 4:35377021-35377043 TACCACGGACTGGCAGGTAGGGG + Intergenic
975476758 4:74832522-74832544 GACCACTGGATAGAAGGTAGTGG - Intergenic
975514695 4:75233718-75233740 TAAAACTGGATGGCAATTTGAGG - Intergenic
977705252 4:100063523-100063545 TGCCACAGGATGGCAGTAAAAGG - Intergenic
980227545 4:130006226-130006248 TACCACCGCATCTCAGTTAGAGG - Intergenic
980514336 4:133834727-133834749 TACCACTGGAGGGTAGTGGGGGG - Intergenic
980867361 4:138568599-138568621 TACAGCTAGATGGCATTTAGAGG + Intergenic
981583025 4:146269955-146269977 TACCACTGGAAGGTAATTAAAGG - Intronic
982248224 4:153377139-153377161 TGCCACTGGAAGGTAGTTTGGGG + Intronic
983596345 4:169472215-169472237 TAAAACTGGATGGCCGTTTGGGG - Intronic
984884487 4:184438215-184438237 TACCACTTAATGGCTGTAAGTGG - Intronic
992016999 5:72585524-72585546 ACTCACTGGATGGCAGTGAGGGG - Intergenic
992285275 5:75228804-75228826 TACCACTAGAAAGGAGTTAGAGG - Intronic
993092498 5:83443381-83443403 TGTCACTGGATGACAGTGAGAGG + Intergenic
993149762 5:84146108-84146130 CACTACAGGATGGCAGTTAATGG + Intronic
996993557 5:129667187-129667209 GACCACTGGATGCCACTTACTGG + Intronic
997452584 5:133995594-133995616 TACCACTACCTGGCAGTTGGGGG - Intronic
1003934610 6:10962472-10962494 TACCCATGGTTGGTAGTTAGTGG + Intronic
1005463117 6:26087682-26087704 TACCACTGAACTGCAGATAGGGG + Intronic
1008301423 6:49845105-49845127 CTACACTGGATGGAAGTTAGAGG - Intronic
1012803934 6:103870733-103870755 TTCCTCTGGGTGGCTGTTAGAGG + Intergenic
1017618251 6:156267773-156267795 TACCACTGCATGGTGGTCAGTGG + Intergenic
1018657875 6:166056900-166056922 TAACACTGGATGGAAGAGAGAGG - Intergenic
1027900521 7:84108389-84108411 GAGCAGTGGAAGGCAGTTAGAGG + Intronic
1028567958 7:92253781-92253803 TACCACTGGTAGGCAGGTACAGG - Intronic
1029329365 7:99838988-99839010 TACCATTTACTGGCAGTTAGAGG - Intronic
1031259428 7:119499252-119499274 TACCAGAGGCTGGCAGGTAGGGG - Intergenic
1033927473 7:146481078-146481100 TACTACTGGCTGGCAGTTTCAGG - Intronic
1034118264 7:148603872-148603894 TACCATTTGATGGTAGTTACTGG + Intronic
1035496899 7:159335805-159335827 TAGCACTGCATGGCAGTGTGGGG - Intergenic
1041729977 8:61053270-61053292 TACCACTGGAGTGCAGGTAGAGG + Intergenic
1041908856 8:63066525-63066547 TACTACTGGAAGGCTGTCAGAGG - Intronic
1045165951 8:99605167-99605189 TACCACTGGAGGTCAGTCATGGG - Intronic
1051593171 9:18796887-18796909 TTCCACTTGCTGGCAGATAGTGG + Intronic
1055923813 9:81489492-81489514 AACACCTGGAGGGCAGTTAGAGG + Intergenic
1057012445 9:91617128-91617150 AAGCACTGGATGGCAGCAAGGGG - Intronic
1059426953 9:114227202-114227224 GTCCACTGGCTGGCAGTCAGGGG + Intronic
1188593295 X:31865331-31865353 AAACACTGGATGACAGTTACTGG - Intronic
1189370152 X:40421434-40421456 TACCTCTTGATGGGAGTTATGGG + Intergenic
1194901650 X:99519757-99519779 TACCACTGGAGCTGAGTTAGTGG + Intergenic
1195109397 X:101630624-101630646 TACCACGGGATGGGGGTAAGGGG - Intergenic