ID: 1181832875

View in Genome Browser
Species Human (GRCh38)
Location 22:25576613-25576635
Sequence AGGGAGAAGCTAATTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181832875 Original CRISPR AGGGAGAAGCTAATTGCTCA AGG Intronic
900354283 1:2252598-2252620 AGGGAGCAGCCCCTTGCTCACGG + Intronic
902300033 1:15495126-15495148 AGAGAGAAGTAACTTGCTCAGGG + Intronic
902657143 1:17877008-17877030 AGGGTGGAGTTAATTGCACATGG + Intergenic
904058340 1:27686800-27686822 AGGGTGCGGCTAATTCCTCAGGG + Intergenic
905190363 1:36229005-36229027 AAGAAAAAGGTAATTGCTCAAGG + Intronic
905868672 1:41390717-41390739 TCAGAGAAGCTAATTGCCCAGGG - Intergenic
907568796 1:55463902-55463924 AGGGAAAAGCACACTGCTCAGGG - Intergenic
907579595 1:55559675-55559697 AGGGTTAAGTAAATTGCTCAAGG + Intergenic
907725521 1:57016926-57016948 AAGGAAAAGCAACTTGCTCAGGG + Intronic
908145436 1:61236188-61236210 AGAGAGAAGCCAATTTCTCTAGG + Intronic
909842995 1:80353162-80353184 AGAGAGAACCCAATTGCACAAGG + Intergenic
910988490 1:93029879-93029901 AGAGATAAGGTAATTGTTCATGG - Intergenic
912549688 1:110477171-110477193 ATGGAGAAGTAACTTGCTCAAGG - Intergenic
917500655 1:175582191-175582213 AGGCTGAAGCTAATTGCCCCAGG + Intronic
917800316 1:178563650-178563672 AGGGAGCAGCTGAGTGCTCCCGG + Intergenic
918691484 1:187485912-187485934 AGGGAGAAGCTAAGTGCCAGTGG - Intergenic
920813131 1:209305652-209305674 AGGGACAAGCTGATTCCCCAGGG + Intergenic
920824629 1:209413852-209413874 AGGGAGAAGCACTTTGCTTATGG - Intergenic
922737381 1:227994799-227994821 GGGGAGAATCTCATTCCTCAGGG - Intergenic
922908841 1:229198367-229198389 GGGGAGAAGCAACTTGCCCAAGG + Intergenic
923115925 1:230937869-230937891 AAGGAGAAACTGATTGCCCATGG + Intronic
1063521216 10:6743012-6743034 AGGGAGAAGCCATTTCCTGATGG - Intergenic
1063749727 10:8929759-8929781 AGGCAGGAGGTAATTGCTCCCGG + Intergenic
1067473802 10:46553597-46553619 AGTGGGATGCTCATTGCTCATGG - Intronic
1068009323 10:51428031-51428053 AGAGAGAAGCTAAGGGCACATGG + Intronic
1071337089 10:84609356-84609378 AAGGATAAGTGAATTGCTCAAGG - Intergenic
1074113554 10:110439218-110439240 TGGGACAAGCTACTTGCCCAAGG + Intergenic
1075490391 10:122862828-122862850 TGGGAGAAACCAATTGCTGATGG + Intronic
1077383531 11:2258504-2258526 AGGGAGAAGCCAATGGCATAGGG + Intergenic
1078413465 11:11146806-11146828 AGGGGAAAGCTAATTGCCCATGG + Intergenic
1079549587 11:21677449-21677471 AAAGAGAAGCTTATTTCTCATGG + Intergenic
1082770246 11:57202348-57202370 TGGTAGAAGCTTCTTGCTCAGGG - Intergenic
1085777171 11:79377459-79377481 AGAGAGAAGGGACTTGCTCAGGG - Intronic
1086143310 11:83522737-83522759 AAAGAGAAGCTATTTGCTCCAGG + Intronic
1087407877 11:97752347-97752369 AGGTACATGCTAATTGGTCATGG + Intergenic
1088786453 11:113186506-113186528 AGGCACAAGCTAATTGCTATAGG + Intronic
1092029716 12:5274191-5274213 AGGGGGAAGCGACTTGCCCAGGG + Intergenic
1092966537 12:13649066-13649088 AGGTAGCAGGGAATTGCTCAAGG - Intronic
1093797435 12:23329377-23329399 AGGGATAAACTAAATTCTCAGGG + Intergenic
1094200066 12:27786084-27786106 ACAGAGAAGTAAATTGCTCAAGG + Intronic
1095163935 12:38949502-38949524 AGGGAGAAGCTAAATTGGCATGG + Intergenic
1095292953 12:40497083-40497105 AGGCAGAATCTAATGGATCAGGG - Intronic
1097686369 12:62694735-62694757 AAGGTGAAGCTACATGCTCAAGG - Intronic
1098183841 12:67876245-67876267 AGGGAGAATATAATTGCTTGGGG + Intergenic
1098584681 12:72141931-72141953 AGGGAGAGGCTAGTTCCTGATGG + Intronic
1100741261 12:97596006-97596028 AGAGAAAAGCTACTTGCTAAGGG + Intergenic
1106431354 13:29683517-29683539 AGAGAGAAGCAACTTGCTCAAGG - Intergenic
1107808351 13:44175571-44175593 AGGGAGAATCTGTTTGCGCAGGG - Intergenic
1108760501 13:53557476-53557498 AGAGTGAAGTGAATTGCTCAGGG + Intergenic
1111079764 13:83288769-83288791 AGACAGAAGCTAATTATTCAAGG + Intergenic
1113074391 13:106453465-106453487 AGGGAGAAGGAAACTGCTGAGGG + Intergenic
1117976197 14:61299197-61299219 AGGGAGAATTTAAATCCTCATGG + Intronic
1119907798 14:78321316-78321338 AGGGAGAAGTAAATGGGTCAGGG + Intronic
1120081637 14:80224192-80224214 AGGGTGAAGCAAATTGCCAAAGG + Intronic
1121179805 14:91920429-91920451 ACGGAGAAGTGACTTGCTCAAGG + Intronic
1121325067 14:93015057-93015079 AGGCAGGAGCAAATGGCTCAGGG + Intronic
1121561553 14:94880013-94880035 AGGCAGAAACTAATTGCCCTTGG + Intergenic
1128765349 15:70247955-70247977 AGGGAGAAGTCACTTGCCCAGGG + Intergenic
1132596325 16:752166-752188 AGGGAGAAGCCACCAGCTCAGGG - Intronic
1133455841 16:5941769-5941791 AGTGAGAAGCTATGAGCTCACGG - Intergenic
1133693421 16:8237633-8237655 AGGGGTAAGCGATTTGCTCAAGG - Intergenic
1136504943 16:30697281-30697303 AAGGTGAAGTTAATTGCTCAAGG + Intergenic
1136635553 16:31520251-31520273 AGGGAGACACCAACTGCTCAGGG + Intergenic
1137063702 16:35814800-35814822 AGAAAGAAGCTAATTTCTGAGGG - Intergenic
1139300722 16:65943096-65943118 GGGAAGAAGCAACTTGCTCAGGG - Intergenic
1140340204 16:74151023-74151045 AGGAAGAAGCTACTTTCTCCTGG + Intergenic
1140861233 16:79019956-79019978 AGTGAGAGGCTAACTGATCACGG - Intronic
1140863526 16:79040023-79040045 AGGGTGATGCTAATTGCCCAAGG - Intronic
1142428981 16:90016336-90016358 AGGAAGAAGAAAATTCCTCACGG + Intronic
1143186787 17:5014829-5014851 ATGGAGAAGGTAATGGCTGAGGG + Exonic
1144157655 17:12522573-12522595 AGGGAAAAAAAAATTGCTCAGGG - Intergenic
1145915768 17:28573227-28573249 AGGGAGAAGCTACCTCATCATGG + Exonic
1148956923 17:51361791-51361813 AGGGAGAGGCCATTTCCTCAAGG - Intergenic
1149337149 17:55647238-55647260 AAAGAGAAGCTTATGGCTCATGG + Intergenic
1151500433 17:74484661-74484683 AGGGAGGAGAGAATTGCTCATGG + Exonic
1155349720 18:24894683-24894705 AGGGAGAAGGAAAATGCACAGGG + Intergenic
1156069638 18:33190948-33190970 AGTGAGAAGCAAATTGCTGATGG - Intronic
1156509588 18:37625318-37625340 AGGGAGAAGCAAAATCCTCATGG - Intergenic
1159770149 18:72539461-72539483 AGGGAGCAGCACATTGCTCAGGG - Intronic
1162117746 19:8441809-8441831 GTGGAGGAGCTGATTGCTCAAGG + Intronic
1166919919 19:46222148-46222170 AAGGAGAAGCACATTCCTCAGGG - Intergenic
1167074186 19:47239156-47239178 GCGGAGAAGCTGCTTGCTCAAGG - Intergenic
1168463536 19:56582987-56583009 AAGGAGTAGCTAACTGCACAGGG + Intronic
925553668 2:5104857-5104879 AAGGAGATGCAATTTGCTCATGG + Intergenic
926083115 2:10004640-10004662 AGGCAGCAGCTAATTCCTGAGGG - Intergenic
926290688 2:11527301-11527323 AGGGAAAAGATATTTTCTCATGG + Intergenic
926844839 2:17124816-17124838 AGGGTGAAGTGACTTGCTCAGGG - Intergenic
926933633 2:18065183-18065205 AGGTAGAAGAGAATTGGTCATGG - Intronic
928046044 2:27933389-27933411 AAGGAAAAGGTAATTGATCATGG + Intronic
928884477 2:36132651-36132673 AGGGACATACTAATTGCTGATGG + Intergenic
932940489 2:76159239-76159261 AGGCAGAAGCTACATGATCAGGG + Intergenic
934045259 2:88168605-88168627 AGAGAGAAGCAAAACGCTCAGGG - Intergenic
934773168 2:96920928-96920950 AGGCAGGAGCTAATTGCACAAGG + Intronic
935502041 2:103853575-103853597 AGTTAGAAGCTAAATGCTGAAGG + Intergenic
936228298 2:110678183-110678205 TGGGAGGAGCTACTGGCTCAAGG - Intergenic
937585742 2:123546842-123546864 ACAGAGAAGTTACTTGCTCAAGG + Intergenic
939002214 2:136749249-136749271 ACAGAAAAGCAAATTGCTCAAGG - Intergenic
939087496 2:137738976-137738998 AGGGAGAAGCTAGGAGCTGAGGG + Intergenic
939491047 2:142876803-142876825 AGGGTTAAGTGAATTGCTCAGGG + Intergenic
941262678 2:163317430-163317452 AGGGAGAAGCTAACTCCCTAGGG + Intergenic
945063801 2:205931408-205931430 AGGCAGAAGCAAGTGGCTCAAGG + Intergenic
945325424 2:208476770-208476792 AGGGAGAACCTTATTGCTGCGGG + Intronic
947169455 2:227296836-227296858 AGAGGGAGGCTAATAGCTCAGGG - Intronic
948208967 2:236178562-236178584 AGCAAGTAGCTAATTTCTCAGGG + Intergenic
1170423629 20:16216963-16216985 AGGGAGGAGCTCATTTCTTAAGG - Intergenic
1171501611 20:25598052-25598074 GGGGAGCAGTTAATTGCACAGGG - Intergenic
1172765321 20:37347636-37347658 AGGGAAAAGTGAATTGCTTACGG - Intronic
1173070833 20:39763424-39763446 AAGGAGAAGCTAGTTTCTGAGGG + Intergenic
1174525160 20:51164694-51164716 AGGGAGAAGCAGCTTGCCCAAGG - Intergenic
1174915609 20:54650178-54650200 AGGAAGAAAATAATTGCTAATGG + Intronic
1175557378 20:59876603-59876625 AGAGAGAAGGAATTTGCTCAAGG - Intronic
1179066795 21:38032286-38032308 AGGCAGATGCAAATTGCTCTGGG + Intronic
1180636806 22:17268319-17268341 AGGCTGAAGCAAATTGCTCCAGG - Intergenic
1180842864 22:18967434-18967456 AGGCAGACGCTAATGCCTCAGGG - Intergenic
1181547567 22:23611028-23611050 AAGGAGAAGCTCTTGGCTCAGGG - Intronic
1181832875 22:25576613-25576635 AGGGAGAAGCTAATTGCTCAAGG + Intronic
1182055379 22:27349433-27349455 AGGGAGAGGCTATTTCCTGATGG - Intergenic
1182094351 22:27615956-27615978 AGGAAGAAGACATTTGCTCAAGG - Intergenic
1182435847 22:30329206-30329228 AGAGAGAAGTAATTTGCTCAAGG - Intergenic
1184741029 22:46429157-46429179 GGGGAGAAGCTTATTCCCCACGG - Intronic
950020503 3:9784157-9784179 AAGGAGGAGCTAATTGCCCAGGG - Exonic
950378425 3:12591001-12591023 AGGGAGGAGGAAAGTGCTCAGGG + Intronic
955795961 3:62637226-62637248 GGGGAGAAGCTACTTGGTCAAGG + Intronic
955920611 3:63951299-63951321 AGGGAGAAGAAAATTCCTTAAGG - Intronic
956217159 3:66860532-66860554 AGGGAGATGCTAATGACACAGGG - Intergenic
961865505 3:129950801-129950823 AGGGTGAAGGCACTTGCTCAAGG + Intergenic
964575921 3:158168245-158168267 TGGTAGAAGCTAAATGATCAAGG - Intronic
965545093 3:169907991-169908013 AGGGAAAAGCTAAGTGCAGAAGG + Intergenic
966298737 3:178454856-178454878 AGGGAATAGCTAATAGCTGACGG + Intronic
967857366 3:194128594-194128616 AGGAAGAAGCGACTTGCACAGGG - Intergenic
967974806 3:195027765-195027787 AGGGAGAGGCCATTTCCTCATGG + Intergenic
968065106 3:195754156-195754178 TGGGAGCAGCTGATAGCTCAAGG - Intronic
969311635 4:6356374-6356396 GAGGAGAAGCCAATTGCTCAGGG + Intronic
970678538 4:18480568-18480590 GGGGAGAAGAGATTTGCTCAAGG - Intergenic
973024891 4:45255681-45255703 AGAGAGAAGTAAATTGCACAGGG - Intergenic
974664291 4:64937696-64937718 AGGGAGAGGCTATTTCCTGATGG - Intergenic
975539732 4:75495696-75495718 AGGCAGAAGTTCATTTCTCATGG - Intronic
977096782 4:92755933-92755955 ACGGAAAAGATAAATGCTCATGG - Intronic
977561671 4:98539299-98539321 TGGGAGAAGCTCATGGCTCCTGG - Intronic
977720822 4:100238464-100238486 AGGGAGAGGCTATTTCCTGATGG + Intergenic
982401501 4:154972715-154972737 AGTGAGAAGCTACCTGCTCACGG - Intergenic
982446501 4:155496531-155496553 CGGGAGAAGCCATTTCCTCAGGG + Intergenic
982573408 4:157077006-157077028 AAGGAGAAGCAAATTTCTGAGGG + Intronic
984156786 4:176204080-176204102 AGGGAGAAGTTACATTCTCAAGG + Intergenic
984781581 4:183531083-183531105 AGAGAGAGACTCATTGCTCAGGG + Intergenic
990493057 5:56320821-56320843 AGGTAGAAGCCATCTGCTCAAGG + Intergenic
994219481 5:97179252-97179274 AAGGAGAAGTTAATTTCGCAGGG - Intronic
997561783 5:134852347-134852369 AGTGAGAAGCTACTTGTTTATGG - Intronic
997923289 5:138003607-138003629 AGGGAGGAGCTAGTTTCCCATGG - Intronic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
1000119172 5:158180170-158180192 AAGGAGAAGCAACTTGCCCAAGG - Intergenic
1000232677 5:159330730-159330752 ATGGAGATGCTAATTTCTCTGGG + Exonic
1000367292 5:160503613-160503635 AGAGAAAAGCAACTTGCTCAAGG - Intergenic
1000497623 5:162004691-162004713 AGGGAGAATGTAATTGCTATAGG - Intergenic
1002137045 5:177114076-177114098 AGGGAGAAGCAGAGGGCTCATGG - Intergenic
1002210195 5:177594299-177594321 AGGGAGAAGCCCACTGCTCCCGG - Intronic
1002341713 5:178520661-178520683 AAGGAGAAGGGATTTGCTCAAGG - Intronic
1002861259 6:1081176-1081198 TGGGACATGGTAATTGCTCAAGG + Intergenic
1002863751 6:1102882-1102904 AGAGAGAAGCCGAGTGCTCATGG + Intergenic
1006438285 6:34038224-34038246 GAGGAGAAGCCATTTGCTCAAGG - Intronic
1008263658 6:49397571-49397593 AGAGAGAAGACAATGGCTCAGGG + Intergenic
1008495389 6:52128151-52128173 TGGGAGAAGCTCATGTCTCAAGG - Intergenic
1008516529 6:52324366-52324388 AGGGAGAGGCCAATTCCTGACGG - Intergenic
1011226274 6:85111081-85111103 GGGGACAATATAATTGCTCACGG + Intergenic
1011849617 6:91610178-91610200 AGGTGAAAGCTACTTGCTCAAGG - Intergenic
1014270635 6:119331966-119331988 AGGGGCAAGCAAATTGCCCAGGG - Intronic
1014351988 6:120357302-120357324 AAGGAGAAGCTAAGAGCTCTTGG - Intergenic
1020354279 7:7259869-7259891 GGGGAAAAGCTCATTCCTCAAGG + Intergenic
1020764286 7:12301419-12301441 AGGGAGAAGCAACTTCCTGATGG - Intergenic
1021179140 7:17485825-17485847 AGAGAAAAGCTATTTGCACAAGG + Intergenic
1021764249 7:23930968-23930990 AGGGTGAATCACATTGCTCATGG + Intergenic
1022652440 7:32289687-32289709 ATGGAGAAGTGACTTGCTCAAGG - Intronic
1022802927 7:33792857-33792879 GGGGAAAAGCCATTTGCTCATGG + Intergenic
1027751552 7:82154075-82154097 AAGCAGAAGCTTATTGCTCATGG - Intronic
1028360802 7:89964288-89964310 AGGGAGAAGCCATTTCCTGATGG + Intergenic
1029274694 7:99397189-99397211 AAGGGGAAACCAATTGCTCAGGG - Intronic
1030442651 7:109607294-109607316 ATGGACAAGCTAAATGTTCAAGG + Intergenic
1031765341 7:125770751-125770773 TGGGAGAAGCCATTTCCTCATGG - Intergenic
1032719796 7:134541563-134541585 AGGGAGGAGGAACTTGCTCAAGG + Intergenic
1034577700 7:152015316-152015338 AAGGAGAAGCTATTTGCTTCAGG - Intronic
1036592643 8:10182876-10182898 AGTGAGAAGCAAGTTACTCAAGG + Intronic
1038721886 8:30044442-30044464 AGAGAGAGGTTATTTGCTCAAGG - Intergenic
1039548362 8:38425971-38425993 AGGGAGAAGTGACCTGCTCAAGG + Intronic
1041661944 8:60409425-60409447 AGAGTGAAGCAATTTGCTCAAGG + Intergenic
1044952063 8:97444623-97444645 AAGGAGAAGCAATGTGCTCAGGG - Intergenic
1045114708 8:98970506-98970528 AGGGAGCAGCTATATGCTGAAGG - Intergenic
1045807042 8:106175263-106175285 AGGGGGAAGGTAATTTCTCAAGG - Intergenic
1047643003 8:126840582-126840604 AGGAAGAGACTCATTGCTCAGGG + Intergenic
1049971316 9:824539-824561 AGGGAGCAGCTAATTTCACCTGG - Intergenic
1051080498 9:13288336-13288358 AGGGAGAGGCTATTTCCTCATGG + Intergenic
1051391736 9:16572625-16572647 AGGGAGCACTTAATTGCTCCGGG + Intronic
1052337248 9:27332601-27332623 GAGCAGAAGCTATTTGCTCAAGG + Intronic
1053479802 9:38407727-38407749 GAGGAGAAGCTACTTGCCCAAGG - Intergenic
1055249867 9:74291007-74291029 AGGGAAAAGCTAAATTCTGATGG + Intergenic
1055705111 9:78990825-78990847 AGGGGGAAGACATTTGCTCAAGG + Intergenic
1057883157 9:98808314-98808336 AGGGAGATGATAACTTCTCAAGG - Intronic
1059504499 9:114785913-114785935 AGGAAGAAGTTACTTGCCCAGGG - Exonic
1060379781 9:123157064-123157086 AGAGATGAGCTAACTGCTCAAGG + Intronic
1062051716 9:134450698-134450720 AGACAGCAGCTTATTGCTCATGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1192347935 X:70327367-70327389 AGGGAGAAGCTAAAGGATCAGGG + Intronic
1193583713 X:83294866-83294888 AGGGAGAAGCCATTTCCTGATGG + Intergenic
1196285538 X:113874926-113874948 AGGAAGAAGCCAGTTGCCCATGG - Intergenic
1196310892 X:114163747-114163769 AAGGTTAAGCAAATTGCTCAAGG + Intergenic
1197725183 X:129771420-129771442 AGGGAGAAGTGACTTGCCCAAGG - Intergenic
1198221050 X:134602802-134602824 AGGGAGAAGCCAATTACAAAGGG + Intronic
1199935071 X:152565260-152565282 ATGGAGAAGCTAGTAGCTAAGGG + Intergenic
1201392306 Y:13512350-13512372 AGAGAGATGCTCATTGCTTAGGG + Intergenic