ID: 1181833119

View in Genome Browser
Species Human (GRCh38)
Location 22:25578992-25579014
Sequence ACTGCTGGTGGTGATCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181833119_1181833126 24 Left 1181833119 22:25578992-25579014 CCTCATTGATCACCACCAGCAGT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1181833126 22:25579039-25579061 CTGAATAGTGGCAATTGAAAAGG 0: 1
1: 0
2: 1
3: 7
4: 196
1181833119_1181833125 12 Left 1181833119 22:25578992-25579014 CCTCATTGATCACCACCAGCAGT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1181833125 22:25579027-25579049 CCTACTCTGTCTCTGAATAGTGG 0: 1
1: 0
2: 1
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181833119 Original CRISPR ACTGCTGGTGGTGATCAATG AGG (reversed) Intronic
900868795 1:5287343-5287365 AGTGCTGATGATGATCATTGTGG - Intergenic
901260443 1:7866769-7866791 AATGATGGTGGGGTTCAATGGGG - Intergenic
901670495 1:10853241-10853263 AGTGATGGTGGTGATCATGGTGG - Intergenic
906958409 1:50397164-50397186 ACTGCTGGTGTTGAAGAAAGAGG - Intergenic
911622243 1:100078527-100078549 ACTGCTGATGCTGATCAACAGGG + Exonic
912087290 1:106024538-106024560 CTTGCTGGTGGTAAACAATGTGG - Intergenic
920603901 1:207360967-207360989 ACTGCTAGTTGTGATAACTGTGG - Intergenic
920794377 1:209124407-209124429 ATTGCTGGTTTTGATGAATGTGG + Intergenic
924202046 1:241670642-241670664 ACAGCAGGAGGTGATCAGTGGGG + Intronic
1063915258 10:10875610-10875632 AATGGTGGTGGTGATCATAGTGG + Intergenic
1066393297 10:34996115-34996137 ACAGCTGGTGGTGGGGAATGTGG + Intergenic
1068492686 10:57743576-57743598 ACTGTTGATGGTGATAAATTTGG - Intergenic
1068663272 10:59646412-59646434 ACTGCTGGAGGTGACCCAGGGGG + Intergenic
1073192136 10:101659128-101659150 CCTCCTGGTGGTGATTAATCTGG - Intronic
1076784099 10:132740831-132740853 AATGCTGGGGGTGAACGATGTGG - Intronic
1077097152 11:803905-803927 ACTGGGGGTGGTGATCACCGAGG + Intronic
1077905205 11:6527332-6527354 AGGGCAGGTGGTGGTCAATGTGG + Intronic
1081702677 11:45161912-45161934 CCTGCCGGTGGTGACCTATGTGG - Intronic
1090832048 11:130426981-130427003 CCAGCTGGTTGTGATCAATGGGG - Intronic
1093461808 12:19413771-19413793 GCTGCTGGTAGTGAGCAGTGAGG + Intronic
1097900851 12:64872643-64872665 ACTGCTGGTGCTGCTGCATGGGG + Intronic
1101521220 12:105484165-105484187 ACTAGGGGAGGTGATCAATGGGG + Intergenic
1101922068 12:108941133-108941155 CCTGCTGGAGCTGAGCAATGTGG + Intronic
1102013862 12:109635274-109635296 AATGGTGGTGGTGATCATGGTGG - Intergenic
1102013893 12:109635406-109635428 AATGGTGGTGGTGATCATGGTGG - Intergenic
1103608338 12:122105140-122105162 ACTGTTGGTGGTGCTAAATTGGG + Intronic
1105811205 13:23997295-23997317 ACTTTTGGTGGTGATGAATATGG - Intronic
1110971310 13:81765460-81765482 ACTGCTGGTGGTGGGAGATGGGG - Intergenic
1114892546 14:26943305-26943327 AGTGGTGGTGATGATCTATGGGG + Intergenic
1119846591 14:77834980-77835002 ACTGCTGGAGGTTTTCAGTGGGG - Intronic
1129480734 15:75823552-75823574 ACTGCTGGTGGTGTGAACTGGGG + Intergenic
1131046794 15:89321742-89321764 ATTGCTGGCGGTGAGCCATGTGG + Exonic
1134109688 16:11507280-11507302 ACTGCAGGTGGTGATGATGGTGG + Intronic
1138447090 16:57071157-57071179 AGTGGTGATGGTGATTAATGGGG + Intronic
1138447184 16:57071561-57071583 AGTGGTGGTGGTGGTTAATGGGG + Intronic
1139872975 16:70122518-70122540 ACTTCTGGTGGTGATAAACCTGG + Intronic
1145758130 17:27407862-27407884 ACTGGTTGTGGAGTTCAATGAGG + Intergenic
1149084589 17:52699914-52699936 ACTCCTGTTGGTGAGGAATGAGG - Intergenic
1152057586 17:78042748-78042770 GATGCTGGTGGTGATCATGGTGG + Intronic
1152059377 17:78058775-78058797 TGTGCTGGTGGTGACCACTGTGG + Intronic
1153113743 18:1627824-1627846 ACTACTGGTGTTCATCAATATGG - Intergenic
1156451228 18:37267460-37267482 AAGGCTGGTGGTGACTAATGTGG + Intronic
1159801747 18:72908707-72908729 AGTGCTGATGGTGAACAAGGTGG + Intergenic
1163098296 19:15077281-15077303 ACAGCAGGAGGTGAGCAATGGGG - Intergenic
1163816475 19:19468004-19468026 ACTTCTGGTTGTGTTGAATGAGG + Intronic
1164394305 19:27850434-27850456 AGTGGTGGTGGTGATGAAAGAGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167610602 19:50506208-50506230 GCTGCTGGTAGTGACCAAGGAGG - Exonic
926753957 2:16221365-16221387 TCTGCTGGTGGTGAACTATGAGG - Intergenic
927010718 2:18900845-18900867 ACTGCTGGTGGTGATGTTGGGGG + Intergenic
932715931 2:74100841-74100863 GCTGCTGGTGGTGAGGAGTGGGG - Exonic
932749926 2:74365062-74365084 ATTGCTGGTGGTGAGTACTGTGG - Exonic
935038878 2:99406305-99406327 AAGGTTGGTGGTCATCAATGTGG - Exonic
935103306 2:100016838-100016860 AATGGTGGTGGTGATGAAGGTGG + Intronic
936955771 2:118020792-118020814 AGTGTTGGTTGTGACCAATGAGG + Intergenic
938238442 2:129724456-129724478 CCTGGTGGAGGTGAACAATGAGG - Intergenic
941499394 2:166251049-166251071 ACAGATGGTGATGACCAATGGGG + Intronic
944271308 2:197786793-197786815 ACTGCTGGAGGTGCTCAGCGGGG - Intergenic
944938502 2:204595504-204595526 AATGCTGGTGATGAGGAATGAGG + Intronic
947058195 2:226131845-226131867 ATTGCTGGTGTTGCTGAATGGGG - Intergenic
948140060 2:235666053-235666075 GCTGCTGAGGGTGATGAATGGGG + Intronic
1168868194 20:1107058-1107080 AGTGCTGGAGGTGAGCAAGGAGG - Intergenic
1169066823 20:2698484-2698506 ACTGCTGATGATGATCAAGCTGG - Intronic
1171195193 20:23191691-23191713 AGGGCTGGTGGTGGTCACTGAGG - Intergenic
1174029690 20:47612600-47612622 GTTGCTGGTGGTGATTGATGAGG + Intronic
1174139432 20:48402755-48402777 ACTGCTCATGGTGATCTCTGGGG - Intergenic
1174158368 20:48532239-48532261 ACAGCAGGTGGTGAGCACTGTGG - Intergenic
1175734525 20:61376112-61376134 AGTGGTGGTGGTGATGAAGGTGG + Intronic
1177846417 21:26293294-26293316 ACTGCTGTTGGTTTTCAGTGTGG + Intergenic
1178571341 21:33739958-33739980 TCTGGTGGTGATAATCAATGTGG + Intronic
1181833119 22:25578992-25579014 ACTGCTGGTGGTGATCAATGAGG - Intronic
1185201030 22:49505214-49505236 AATGGTGGTGGTGATCATGGTGG + Intronic
949534006 3:4981460-4981482 TCTGCTGCTGCTGATCAATTAGG - Exonic
953152477 3:40337536-40337558 ACTGCTGGTAGTGGGCCATGGGG + Intergenic
953348389 3:42195566-42195588 TCTGCTGGGGGTCAGCAATGGGG - Intronic
953590669 3:44249912-44249934 ATTGATGTTGGTGATCAGTGGGG + Intronic
954443867 3:50536211-50536233 AGTTCTGCTGGTGAACAATGGGG + Intergenic
955204300 3:56881578-56881600 ACTATTGGTGATGATCAAGGTGG - Intronic
956643972 3:71438625-71438647 ACTGCTGGGGGGTATAAATGAGG - Intronic
957503635 3:81091261-81091283 ACAGCAGGAGGTGAACAATGTGG - Intergenic
958634183 3:96721980-96722002 ACTGATGGTGGCAATCCATGAGG - Intergenic
961039062 3:123664141-123664163 ACTGCTGGTGGAGAACAAGCTGG - Exonic
961076326 3:123986446-123986468 ACTGGAGGTGGTGTTGAATGGGG + Intronic
961082727 3:124040336-124040358 ACTGCTGGAGGTGGTCAGTATGG + Intergenic
961393274 3:126569241-126569263 TATGCTGGTGGTGATCCAAGGGG + Intergenic
962084176 3:132173365-132173387 AGTGCTTGTGGTGCTCCATGTGG - Intronic
964560611 3:157991670-157991692 ATTGCTGGGGGTGATAGATGGGG - Intergenic
965679222 3:171233277-171233299 AGTGCTGGTTATGATCAGTGGGG - Intronic
966363405 3:179154269-179154291 ACAGCTGGAGGTGAGCAGTGGGG + Intronic
967086179 3:186097225-186097247 ACTTCTGGTACTGAGCAATGGGG - Intronic
968182341 3:196605398-196605420 ATTGATGGTGATGAACAATGAGG - Intergenic
976633981 4:87268940-87268962 AATGATGGTGGGGATGAATGTGG - Intergenic
977220026 4:94327499-94327521 AATGCTAGTGGTGATAAGTGTGG + Intronic
977574687 4:98663528-98663550 AATGCTGGTGGTGATTCAAGAGG - Intergenic
977749934 4:100597335-100597357 ACTGCTGGTGGGAATCAAAATGG - Intronic
978024602 4:103857223-103857245 ACTGATGGTTCTTATCAATGTGG + Intergenic
979511254 4:121556364-121556386 AGTGCTGGTGGACATCCATGAGG - Intergenic
980278973 4:130693396-130693418 ACTGGGGGTGGCTATCAATGAGG + Intergenic
982727270 4:158918900-158918922 TCTGGTGGTGGTGTTCATTGTGG - Intronic
983438075 4:167742370-167742392 GCTGATGGTGGTGATGACTGGGG - Intergenic
987069653 5:14323645-14323667 ACAGCTGGGGGTGAATAATGCGG + Intronic
987464480 5:18255309-18255331 ACTGCTGGTTGATATCAATATGG + Intergenic
987790060 5:22553699-22553721 ACTGCTGCTGTAGATCAATTTGG - Intronic
988496483 5:31750238-31750260 ACTGGTGGTGGAGATCAAGTCGG - Intronic
989123562 5:38028968-38028990 ACTGTTGGTGATGCCCAATGAGG + Intergenic
989461796 5:41708327-41708349 CCTGCTGGTGAAGAACAATGGGG + Intergenic
990592937 5:57283914-57283936 AGTGTTGGTGGTAATCATTGGGG + Intergenic
991470496 5:66963835-66963857 AATGCTGGTGGTGGGAAATGGGG - Intronic
992657016 5:78920738-78920760 ACTTCTGATGGTGATCTATGAGG - Intronic
992932811 5:81667428-81667450 AATGCTCTTGGTGTTCAATGAGG - Intronic
995139874 5:108723423-108723445 ACTGCTGGTGGAGATATAAGTGG + Intergenic
996968812 5:129338421-129338443 ACAGCAGGTGGTGATAAAGGAGG - Intergenic
997522860 5:134534464-134534486 CCTGCTGGTGGTGGGCACTGGGG + Intronic
999536468 5:152522964-152522986 ACTCCTTGTGGTAATCAAGGTGG + Intergenic
1002403726 5:179011951-179011973 ACTGGTGGTGGTGGAGAATGGGG + Intergenic
1003678970 6:8233406-8233428 TCCACTGGTGGTGAGCAATGGGG + Intergenic
1006592081 6:35165762-35165784 ACTGCTGCTGGTGATAGAAGGGG + Intergenic
1011132224 6:84063720-84063742 CCTGCTGGTGCTGACTAATGAGG - Intronic
1015785692 6:136920831-136920853 ACTGCTGGTGGTGAACGAAAGGG + Intergenic
1016326950 6:142913682-142913704 ACTGCAGGGGGTGCTGAATGTGG + Intronic
1016800580 6:148164881-148164903 CCTGCTGGTGGTGACCTATGAGG - Intergenic
1017342851 6:153346475-153346497 TTTGCTGGTGGTGATCATGGAGG + Intergenic
1018897913 6:168034034-168034056 ACTGCCGATGGTGATGAGTGGGG + Intronic
1018983480 6:168617770-168617792 ACTGCTTGTTGTGACCGATGGGG + Intronic
1019091008 6:169533614-169533636 ATTGCTGGTGGTGCCCAATGTGG - Intronic
1020648163 7:10841360-10841382 AATGGTGGTGATGATTAATGAGG - Intergenic
1021210176 7:17841118-17841140 ACTGCTGCTTCTGATCAAAGAGG + Intronic
1022242973 7:28530792-28530814 ACTGCGGGTGGAGATGAGTGGGG - Intronic
1027184306 7:75961315-75961337 ACAGCTGGTGGGCATCACTGTGG - Intronic
1027822174 7:83060689-83060711 ACTGGTGGTGGTGGTCCATAGGG + Intronic
1028027641 7:85866695-85866717 AGTGGTGGCGGTGATCACTGTGG + Intergenic
1032779536 7:135152893-135152915 GCTGCTGGTGGTGCCCGATGGGG + Intronic
1033527028 7:142226170-142226192 ACTGCTGGAGGTGGTCTCTGCGG + Intergenic
1036671873 8:10794959-10794981 AATGCAGGTGGTGATAAAGGAGG + Intronic
1040095153 8:43435590-43435612 TCTGCTAGTGGCTATCAATGTGG + Intergenic
1042331331 8:67583683-67583705 ACTGCTGGTGATGAGGAATCCGG + Intronic
1042866557 8:73361840-73361862 ACCTCTAGTGGTGATCAATGAGG + Intergenic
1045669757 8:104536988-104537010 ACTGCTGCTGGTTATAAAAGAGG + Intronic
1048613414 8:136048700-136048722 ACTGGTGGTGGGGATCAGTGAGG - Intergenic
1049228452 8:141469493-141469515 GTTGCTGGTGGTGATGACTGTGG + Intergenic
1056807063 9:89737060-89737082 ACAGCTAGTGGTCATCAAGGGGG - Intergenic
1059407010 9:114107600-114107622 AGTGGTGGTGGTGATGAAGGAGG - Intergenic
1062391739 9:136336590-136336612 ACAGCTGGAGGTGACCAAGGGGG + Intronic
1186547313 X:10464041-10464063 ACTGCTGGTGCTGACCAAACTGG - Intronic
1187271172 X:17781049-17781071 ATTGAAGGTGGTGATCAATGTGG + Intergenic
1189022702 X:37357849-37357871 ACTGCTGGTGGGAATAAAAGCGG - Intronic
1190667696 X:52709863-52709885 ACCTCTGCTGGTGATCAAGGAGG + Intergenic
1190671722 X:52748545-52748567 ACCTCTGCTGGTGATCAAGGAGG - Intergenic
1191953464 X:66619204-66619226 ACTGGTGGTTGCGATTAATGAGG - Intronic
1192123706 X:68480991-68481013 AGGGCTGGTGGTGGGCAATGGGG + Intergenic
1193185543 X:78507795-78507817 ACGGCTTGTGGTGGTCACTGCGG - Intergenic
1199078405 X:143549828-143549850 ACTGCTGGTAGTAAGCCATGAGG - Intergenic