ID: 1181835437

View in Genome Browser
Species Human (GRCh38)
Location 22:25603487-25603509
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181835437 Original CRISPR CAGGATAAACAAACTAATCA AGG (reversed) Intronic
901357398 1:8663123-8663145 CATGATTAAGAAACAAATCATGG + Intronic
903726236 1:25447839-25447861 CAGAATTAACACATTAATCAAGG - Intronic
904230313 1:29064920-29064942 CAGGACAAAGAACATAATCAAGG - Intronic
909129981 1:71722955-71722977 TAGGAAAAACAAACTAATGTGGG - Intronic
909217766 1:72912867-72912889 CTGAATAAATAAAGTAATCAAGG - Intergenic
909749981 1:79147210-79147232 CAGGAGCAAAAAACTAAACATGG - Intergenic
909754241 1:79203536-79203558 CAGGATTAACAAAATAAGGAGGG + Intergenic
909938700 1:81585602-81585624 CAAGTTAAACAAAATAATGAAGG - Intronic
910510818 1:88002027-88002049 GAGGAAAAAAAAACAAATCAAGG + Intergenic
910641797 1:89472182-89472204 CAGGAGACACAAGCTAAGCAAGG + Intergenic
917219383 1:172711532-172711554 CAGGAAAAACAAAGGAATAAAGG - Intergenic
918723809 1:187891791-187891813 AAGAACAAACAAACAAATCAGGG - Intergenic
921607035 1:217167728-217167750 CATGATAACCACAATAATCAAGG - Intergenic
922917885 1:229273067-229273089 CAGGTTAAAGAAACTAAGCCTGG - Intronic
1063398219 10:5713754-5713776 CAGGAAAACCAAACTAAGCAGGG - Intronic
1064277268 10:13917639-13917661 GGGGGTAAACAAACAAATCAAGG + Intronic
1068695205 10:59960521-59960543 CAATATAAACAAACTCTTCATGG - Intronic
1068882490 10:62065231-62065253 CAGGTAAAACAAACCAATCTAGG - Intronic
1069018812 10:63463655-63463677 CAGATTAAAAAAACTCATCAAGG + Intronic
1069774995 10:70921292-70921314 TAGAATAAATAAACAAATCATGG - Intergenic
1071434874 10:85639183-85639205 GAGAATAAATAAACAAATCAAGG + Intronic
1074429644 10:113383106-113383128 CAGCATAAACAAATGAATGAAGG - Intergenic
1079877206 11:25874847-25874869 CAGGATAAACGAAAGAATCTGGG - Intergenic
1079880009 11:25915135-25915157 GAGGATCAAAAAACTAGTCAGGG + Intergenic
1079966439 11:26985839-26985861 TAGGATTAAAAAGCTAATCAAGG + Intergenic
1080998615 11:37638610-37638632 CAGGATAAACAATATTATTAAGG - Intergenic
1083443836 11:62694112-62694134 CAGGATAAAGAAGGGAATCAAGG - Intronic
1086803855 11:91214442-91214464 CAGAATATACATACTATTCAAGG + Intergenic
1087289878 11:96308969-96308991 CAGCATAAACAAATAATTCATGG + Intronic
1088354036 11:108922834-108922856 GAGGATAAATAAACTATTCATGG - Intronic
1088718308 11:112569715-112569737 CATGACACAAAAACTAATCAAGG - Intergenic
1089141453 11:116288194-116288216 CAGGCTAAACTAACCAATCTTGG + Intergenic
1089774067 11:120823939-120823961 GAGGATTAAAAATCTAATCAAGG + Intronic
1090936975 11:131351902-131351924 GAAGAGAAACAAACTAATAAAGG - Intergenic
1093351224 12:18105264-18105286 CAGCAATAACAAACTAATCCAGG - Intronic
1095686530 12:45042354-45042376 CAGGAGAAACATCTTAATCAGGG + Intronic
1097309701 12:58105144-58105166 AAGGATGAACAAAATAGTCATGG + Intergenic
1097455181 12:59791628-59791650 AAGGATGAACAAACAGATCAAGG - Intergenic
1097513829 12:60577794-60577816 CAGGATAAACAGACTTACTATGG - Intergenic
1097650917 12:62296443-62296465 CAGAATAAAGAACATAATCAGGG + Intronic
1099113504 12:78593160-78593182 CAATAAAAACAAACTAAGCAGGG - Intergenic
1103886013 12:124200799-124200821 ATGGATAAACAAACTAATTACGG - Intronic
1109086337 13:57975613-57975635 CAGGATAAAGAAAGTGGTCAGGG + Intergenic
1109695194 13:65946583-65946605 CAGGAAAAATAAACAAATAAAGG + Intergenic
1110120968 13:71881305-71881327 CTGGATGAAGAAACTGATCAAGG + Intergenic
1112106342 13:96243988-96244010 CAAGATAAACAAACTAAAAAAGG + Intronic
1113110248 13:106814929-106814951 AAGGATAAACAATATAATCAAGG + Intergenic
1113347781 13:109497511-109497533 CAGGATAAACTAACTTGTCCAGG - Intergenic
1113895588 13:113762102-113762124 CAGGAAAAAAAAAAAAATCAAGG + Intronic
1115778547 14:36743476-36743498 CAGGAAAGACAACCCAATCATGG + Intronic
1118164947 14:63326914-63326936 CAAGTTAAACAAATTAAACATGG + Intergenic
1120918597 14:89732845-89732867 CAGAATAAACAATATAACCATGG - Intergenic
1121379585 14:93451493-93451515 CAGGATAATCTACCTAACCAAGG - Intronic
1121567411 14:94920727-94920749 AAGGAGAAAGAAAGTAATCAAGG + Intergenic
1125160842 15:36641787-36641809 CAGAATCAAAAAACTAAACAAGG - Intronic
1128956589 15:71953651-71953673 GAGGTTAAAGAAACTAATCTAGG - Intronic
1130300793 15:82678841-82678863 CATGATGAGCAAACTAATCAGGG - Intronic
1130810522 15:87372805-87372827 CAGGAAAAACAAATAAATAAAGG - Intergenic
1131609479 15:93946235-93946257 CATGATAACCAAACAAAGCAAGG + Intergenic
1132109463 15:99091933-99091955 CAGGATAAAGAATACAATCATGG + Intergenic
1133170867 16:3981922-3981944 GAGGAAAAACAAACCAACCAGGG + Intronic
1133444386 16:5847613-5847635 CAGAAAGAACAAACTAATGAAGG - Intergenic
1134185885 16:12084697-12084719 CAGGATCAACACCCAAATCATGG + Intronic
1137510796 16:49098351-49098373 CAGGATAAACATACAAATGCAGG - Intergenic
1139167098 16:64580065-64580087 ATGGATAAACAAACTGATCTTGG + Intergenic
1140289652 16:73641270-73641292 CAGGAAAAACAAACAAAACCAGG + Intergenic
1140532774 16:75681138-75681160 CAGAAAAAACAAAATAATCTTGG + Intronic
1140630214 16:76843276-76843298 CTGGATATACAAACAAATTAAGG - Intergenic
1141049168 16:80745140-80745162 CAAGTTCAACAAACCAATCAAGG + Intronic
1141871842 16:86792022-86792044 AAGGAAAAAAAAAGTAATCAGGG - Intergenic
1146223323 17:31045331-31045353 CAGGATAAATAAAAGAATCATGG + Intergenic
1146341669 17:32024639-32024661 CAGGATAAATAAAAGAATCATGG - Intronic
1146351134 17:32094983-32095005 CAGGATAAATAAAAGAATCATGG + Intergenic
1147233132 17:39034098-39034120 CAGGATAAGTAAAAGAATCATGG - Intergenic
1147905753 17:43821789-43821811 CAGGAAAAAAAAAGCAATCAGGG + Intronic
1149074815 17:52582588-52582610 CAGTATAAACACACTGTTCAAGG - Intergenic
1149215546 17:54349719-54349741 CAGGAGTAACAAATTAACCAAGG + Intergenic
1149509011 17:57222036-57222058 CAGAATAAACAACCAAATTATGG + Intergenic
1150240018 17:63623172-63623194 CAGGAAAAAAAAGCAAATCAAGG - Intronic
1150385249 17:64754029-64754051 CAGGATAACCAGAATAATCTTGG + Intergenic
1150771403 17:68044457-68044479 CAGGATAACCAGAATAATCTTGG - Exonic
1150783947 17:68147573-68147595 CAGGATAAGTAAAAGAATCATGG + Intergenic
1155420595 18:25651385-25651407 CAGGCTAAAGAAACTAAGGATGG - Intergenic
1155855373 18:30827863-30827885 CAGTATAAAAAAGCTAATGATGG - Intergenic
1156663363 18:39375607-39375629 CAGGAAAAACAAGTTAACCAGGG - Intergenic
1156907168 18:42367689-42367711 CAGCATAAATAAATAAATCATGG + Intergenic
1157008974 18:43623568-43623590 CAGAATAAATTAAGTAATCAGGG + Intergenic
1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG + Intronic
1158370646 18:56799029-56799051 AATGATAAACAAAGTAGTCATGG + Intronic
1163779463 19:19239022-19239044 AAGGAAAAAGAAACAAATCAGGG - Intronic
1165647738 19:37457471-37457493 AAGAATAAACAAAATAACCATGG + Intronic
1165787590 19:38471367-38471389 CAGAATAAACAAAATTATCTGGG + Intronic
1168357801 19:55713207-55713229 CATGATATACAAAATAGTCAGGG - Intronic
925521298 2:4748624-4748646 CAGGATAAACAAATTTATTTTGG + Intergenic
925596563 2:5561284-5561306 CAGAATAAATAAATAAATCAAGG + Intergenic
927117465 2:19919078-19919100 CAGGATTAAGAAACTCATCAAGG + Intronic
928503402 2:31922598-31922620 GAGGATAAAAAAACTACTTATGG - Intronic
930059745 2:47278059-47278081 CAGAAGAAACAAAGAAATCAGGG - Intergenic
930318711 2:49827927-49827949 CAGGATTCACACACTAATTATGG + Intergenic
932010339 2:67971252-67971274 TAGGAGAAAAAAACAAATCAAGG + Intergenic
935355697 2:102197505-102197527 CAGGATAAAAAGACTCACCATGG - Intronic
939349760 2:141020331-141020353 CAGTGTTAACAAATTAATCATGG + Intronic
940940940 2:159559595-159559617 TAGGATAAAAAAACTAGTAAAGG + Intronic
941203455 2:162542997-162543019 CAGGCTAAACAGACTATACATGG - Intronic
942474076 2:176297066-176297088 CAGTGTAAACCAACTATTCATGG + Intronic
942819303 2:180092657-180092679 CAGGATAAAGAATCTACTCCAGG + Intergenic
943923121 2:193736650-193736672 CAAGTAAAACAAACTAATGAAGG + Intergenic
945392121 2:209277020-209277042 CAGAATAAACAAACTTAACCAGG - Intergenic
945692864 2:213063419-213063441 CAGGATAAACAAATTTCCCAAGG - Intronic
945939403 2:215933021-215933043 CAGGAGAAACACTCTAATCCGGG + Intergenic
948506579 2:238432089-238432111 CAGTATAAACAACCTAATACCGG - Intronic
1170268019 20:14489606-14489628 CAGAATAAATAAACTAAACTAGG + Intronic
1170406797 20:16046576-16046598 CAAGAAAAACAGACTAATCCTGG - Intronic
1172811102 20:37648928-37648950 CAGGATCAAAAAACTACTGACGG + Intergenic
1173110773 20:40187223-40187245 CATGAAATAAAAACTAATCAAGG - Intergenic
1173346351 20:42204216-42204238 CAGAATTAACAAAATATTCATGG + Intronic
1174077435 20:47948012-47948034 CAGGAAAAAAAAGCTAAGCAAGG + Intergenic
1178017878 21:28372369-28372391 CTTAATAAAAAAACTAATCATGG - Intergenic
1178851980 21:36220065-36220087 CAAAATAAACAAACAAAACAGGG - Intronic
1179268841 21:39832225-39832247 CAGGAATAAGATACTAATCATGG - Intergenic
1181794870 22:25299838-25299860 CAGGATAAACAAACTAATCAAGG - Intergenic
1181835437 22:25603487-25603509 CAGGATAAACAAACTAATCAAGG - Intronic
1184934525 22:47711264-47711286 AATGACTAACAAACTAATCAGGG - Intergenic
949159699 3:865953-865975 CAGGATAAAAAAACACATGAAGG - Intergenic
949996918 3:9625314-9625336 ATGGGTAAACAAACAAATCATGG - Intergenic
951820303 3:26801661-26801683 AAGGCTAAAGAAACTATTCAAGG + Intergenic
953299266 3:41755463-41755485 CAGGTAAAAAAAACAAATCAAGG + Intronic
954253398 3:49386034-49386056 CAGAATAACCAAAATAATCTTGG - Intronic
954766403 3:52921209-52921231 CAGGATAAAAAAGCTGCTCAGGG + Intronic
956570056 3:70684188-70684210 CAGGAAAAACAAACTCATGGGGG - Intergenic
958962349 3:100522307-100522329 CCAGAAAAACAAACAAATCAAGG - Intronic
959312137 3:104752321-104752343 CAGAATAAACAAACTTATATAGG + Intergenic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
959870060 3:111316298-111316320 CAGGATAAATAGACTATGCAGGG + Intronic
962130165 3:132664083-132664105 CAGGAAAAACAAACCAAACAAGG + Intronic
963837434 3:150071258-150071280 CAGGATTAGGAAACTAATAAAGG + Intergenic
964419090 3:156482461-156482483 ATGGAGAAACAAACTAATCATGG + Intronic
964823225 3:160796557-160796579 CAGAATACTCAAACTAATTAAGG - Intronic
966394057 3:179483145-179483167 CAGGAAAAACAGACAAATAAAGG - Intergenic
967235588 3:187380850-187380872 CAGAATAAAGAAAATAAACAGGG - Intergenic
968730130 4:2265603-2265625 CAGGATCCACAAACTCCTCATGG + Intergenic
970696088 4:18678777-18678799 ATGGATTAACAAAATAATCACGG + Intergenic
971387448 4:26154296-26154318 CAGGATAAATAAGATAATGATGG + Intergenic
972278942 4:37585083-37585105 CAGGATAAACAAAGTATTGCAGG + Intronic
975154979 4:71060986-71061008 TATTGTAAACAAACTAATCAAGG + Intergenic
975698293 4:77036706-77036728 CAGCAATAACAAACTAAACAGGG - Exonic
977315746 4:95445254-95445276 CAGGAGAAAAAAACTAAGAATGG - Intronic
977908492 4:102502666-102502688 CAGGATAAACCAGCAAGTCAGGG - Intronic
978584046 4:110258982-110259004 CAGGATAAAATACCTAGTCAAGG - Intergenic
978987241 4:115028288-115028310 CAGGATAAACACTCTTAACAAGG + Intronic
978997092 4:115170235-115170257 CAGAATAAAGAGACTAGTCAAGG - Intergenic
979125006 4:116958578-116958600 CAGTATAAACAAACCCATAATGG + Intergenic
979327334 4:119395181-119395203 CAGGAGAAACAAAATACACAGGG - Intergenic
979382575 4:120025132-120025154 CATCATAATCAAACTACTCAAGG + Intergenic
979989603 4:127360187-127360209 CAAGAACAACAAAGTAATCAAGG + Intergenic
980770006 4:137359338-137359360 CTAGAAAAACAAACTAATAAAGG - Intergenic
980843553 4:138296471-138296493 CAAGAGACACAAAATAATCAAGG - Intergenic
981969950 4:150655275-150655297 CAGGATAAATGAACAAAACAAGG - Intronic
983245216 4:165279869-165279891 CAGGAGAAACAAAATACGCAGGG - Intronic
983454408 4:167944736-167944758 CACGATAAACAAAGTGATGATGG + Intergenic
983645699 4:169989351-169989373 ATCTATAAACAAACTAATCAAGG + Exonic
984507787 4:180641228-180641250 CAGGAAAAACAGACTGGTCAAGG - Intergenic
984652393 4:182284571-182284593 TAGGGTATACAAAATAATCAGGG - Intronic
984897544 4:184554923-184554945 GAGAATAAACAAACTGTTCATGG + Intergenic
984922891 4:184781307-184781329 TAGGGTAAAAAACCTAATCATGG + Intronic
987433370 5:17863591-17863613 CAATAAAAACAAACAAATCAGGG + Intergenic
992946261 5:81813798-81813820 GGGGATAAGAAAACTAATCAGGG + Intergenic
995382983 5:111555639-111555661 GAGGATATACAAACTACTAATGG - Intergenic
995547082 5:113243656-113243678 AAGGATAAACACACTAGGCATGG - Intronic
995798811 5:115969258-115969280 CAGGAAAAAAAAATTAATAATGG - Intronic
997020007 5:129989060-129989082 CAGCATAAACAAACTAAGACAGG - Intronic
999623912 5:153500159-153500181 CAGGATCTTCAAACTAGTCAGGG - Intronic
999661853 5:153872771-153872793 CAGGAGAAACAAACAAATATTGG - Intergenic
999875477 5:155801026-155801048 CCAGATAAACAAAATAATAAAGG - Intergenic
1000059981 5:157646038-157646060 CTGGAAAAACAAACCAATGATGG + Intronic
1005607959 6:27494380-27494402 CAGGTAAAACAAATGAATCAGGG - Intergenic
1005626109 6:27664045-27664067 AAGGCTAAACACACTAATCTAGG - Intergenic
1005971546 6:30765747-30765769 CAGGGTAAACAAAGTAAACTTGG + Intergenic
1008293361 6:49746640-49746662 CAGAAAAGACAACCTAATCATGG - Intergenic
1009435904 6:63618352-63618374 CAGGATGAACAAACCAAAAATGG - Intergenic
1010560743 6:77346419-77346441 TAAGATTAACAAACTACTCATGG - Intergenic
1011173770 6:84537146-84537168 CAGGATAAACAAATGAATATTGG + Intergenic
1012062930 6:94511319-94511341 CAGGATCCACACACTAATTATGG - Intergenic
1014888761 6:126816005-126816027 CAGGATAAAGATATTAATCTTGG + Intergenic
1015037571 6:128675587-128675609 CAGGTTAATCAAAACAATCAAGG + Intergenic
1015633344 6:135252764-135252786 CAGGAAAAAGAAAAAAATCAAGG - Intergenic
1017093053 6:150778835-150778857 CAGGATAAACACAATAAAAATGG - Intronic
1020492323 7:8802917-8802939 CAGCATAAACAGACTAAGAATGG - Intergenic
1020652639 7:10893987-10894009 CAGAATAAACAAAATATTCAAGG - Intergenic
1020678934 7:11213142-11213164 AAGGATAAACAAAGAAATTATGG - Intergenic
1023670616 7:42572255-42572277 TAAGATAAACTAACTAATGAAGG + Intergenic
1024019684 7:45355441-45355463 CAGGATAAAGAAGATTATCAGGG + Intergenic
1024863727 7:53878393-53878415 AAGGAGAAACAAACAAATCCAGG - Intergenic
1026198282 7:68191992-68192014 GAGGTTAAACAAATTGATCAAGG - Intergenic
1026381107 7:69800296-69800318 AAGGTTAAACAAAAAAATCAAGG + Intronic
1027529839 7:79316624-79316646 CAGGATAAGAAAATGAATCAAGG - Intronic
1027808639 7:82863059-82863081 AAAGATAAACAAACACATCATGG - Intronic
1028453157 7:91008291-91008313 CGGGATAACCAGAATAATCAAGG + Intronic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030290103 7:107863804-107863826 AAAGATAAACAAAATAGTCAAGG + Intergenic
1031616738 7:123890225-123890247 CAGAAAAAACAAACAAATAAAGG + Intergenic
1035359701 7:158302611-158302633 CACGATAAACAACCAAAACAGGG + Intronic
1035911613 8:3572437-3572459 CAGGAGAAACACAGCAATCAGGG - Intronic
1036401038 8:8408542-8408564 CAGGACAAGCAAACTATTCCTGG + Intergenic
1037072014 8:14662564-14662586 CAGGTTAAACAACCTAGTGAAGG - Intronic
1037975887 8:23211575-23211597 CAGCATAAACAAAATAATTCTGG + Intronic
1038755537 8:30337131-30337153 GAGGATAAATAAAATAATCCTGG - Intergenic
1039687362 8:39819062-39819084 CAGAATAACCAAAATAATCTTGG + Intronic
1039930073 8:41978643-41978665 CAGGTTAAAGAAACAAAACACGG - Exonic
1039990560 8:42484284-42484306 CAGTATAAACACACTAAACAAGG + Intronic
1041829603 8:62139064-62139086 CCAAATAAACAAACTAAACAAGG - Intergenic
1043350196 8:79351642-79351664 AAAGAAAAACAAAATAATCAAGG + Intergenic
1044903979 8:96979788-96979810 CAGGATAAAGAAAGTATTGAGGG + Intronic
1044919313 8:97150950-97150972 CAGAATAAACCAAATAATTAGGG - Intergenic
1045897060 8:107232271-107232293 CAAAATTAACAAACCAATCAAGG + Intergenic
1046037150 8:108856742-108856764 CAGGAAAAACAAACTCAAAATGG + Intergenic
1046404356 8:113753357-113753379 AAGAATAAGCAAAATAATCATGG - Intergenic
1046435370 8:114180975-114180997 CAGAAAAAAGATACTAATCATGG + Intergenic
1048685021 8:136895086-136895108 CAGGATATAGAAACTGATAAAGG - Intergenic
1051087383 9:13365677-13365699 AAAGAAAAACAAACTAATAAAGG + Intergenic
1053152833 9:35753865-35753887 CAGGAAAGACAAACTAAATACGG - Exonic
1053798028 9:41743833-41743855 AAGGATAAGCAAACAAATTATGG - Intergenic
1058203173 9:102068713-102068735 CAGGAAAAACAAACGAAAAAAGG - Intergenic
1060023031 9:120148736-120148758 CAGCTTTAACAAACTAATAAAGG + Intergenic
1061334107 9:129918631-129918653 GAGAACAAACAAACAAATCAAGG - Intronic
1186627339 X:11308663-11308685 CAGGATCACCAGACTAATCCAGG - Intronic
1187735337 X:22297491-22297513 CTAGATAACAAAACTAATCAGGG - Intergenic
1188464232 X:30460778-30460800 CAGGATCAAGGAACTAATTATGG + Intergenic
1192611044 X:72567414-72567436 CAGTAGAAAGAAATTAATCATGG - Intronic
1193151195 X:78126268-78126290 CAGGAAAAAAAAAAAAATCACGG - Exonic
1193399542 X:81026816-81026838 CATGATAAACAAAATGATCGGGG + Intergenic
1193707101 X:84834280-84834302 AAGGTTAAACAAACTAGTAATGG - Intergenic
1194697336 X:97069898-97069920 CAGCATAAATAAAGTAAACATGG - Intronic
1195709592 X:107763462-107763484 AAGGACAAATAAACTGATCAAGG - Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1201055102 Y:9980768-9980790 TAGGATAAACAGACTTATCTAGG - Intergenic
1201456240 Y:14170152-14170174 CAGGACAAACGAACACATCAGGG - Intergenic
1201589777 Y:15602272-15602294 CAGGTAAGACAAACTTATCATGG - Intergenic