ID: 1181835573

View in Genome Browser
Species Human (GRCh38)
Location 22:25605138-25605160
Sequence CTGTCTGTGAAGAGGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181835570_1181835573 5 Left 1181835570 22:25605110-25605132 CCACTTTATCTGTTTTACGAAAA 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG 0: 1
1: 1
2: 0
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181835573 Original CRISPR CTGTCTGTGAAGAGGTTCTT TGG Intronic
900953935 1:5875358-5875380 GTGTCTGTGAAGAGTCTCTCAGG - Intronic
901202892 1:7476588-7476610 CTGTCTGGGAAGAGGCCCTCAGG + Intronic
901844863 1:11975359-11975381 CTGTCTCCCAAGAGGTTCTCTGG - Exonic
903783676 1:25841210-25841232 CTGTGTGAGAAAAGGTTATTTGG + Intronic
904800428 1:33088702-33088724 TGGTCTGTGCAGAGGTTCTGAGG - Intronic
905298770 1:36971933-36971955 CTCTCTGTGAAGTGCTTCTGCGG + Intronic
906247202 1:44284642-44284664 CTGACTGTGGAGAGCTGCTTGGG - Intronic
906869802 1:49465661-49465683 TTGTCAGTGAAGTGCTTCTTAGG - Intronic
907408959 1:54271574-54271596 GTGGCTGTGAACAGGGTCTTTGG - Intronic
907925928 1:58955181-58955203 GTGTTTGAGAAAAGGTTCTTGGG + Intergenic
911972484 1:104455005-104455027 CTGTCTGAGATGAAGTTCTCAGG - Intergenic
912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG + Intronic
915873873 1:159591561-159591583 CTCTCTGCAAAGAAGTTCTTTGG + Intergenic
915898978 1:159833034-159833056 CCGTCTGTGAAGAGGCTGTGTGG - Exonic
917625803 1:176844962-176844984 TTGTGTGTGAAGAGCCTCTTAGG + Exonic
919284090 1:195531085-195531107 ATGTCTGTGAAGAATGTCTTTGG - Intergenic
922665969 1:227469755-227469777 CTATCTGAAAAAAGGTTCTTAGG - Intergenic
924577488 1:245293515-245293537 CTGGTAGTGAAGAGATTCTTGGG + Intronic
1065521926 10:26581879-26581901 CTCACTGTGAAGAAGTTCCTAGG - Intergenic
1065522155 10:26583725-26583747 CTCACTGTGAAGAAGTTCCTAGG - Intergenic
1065527716 10:26640046-26640068 CTCACTGTGAAGAAGTTCCTAGG - Intergenic
1067044545 10:42976877-42976899 CTGTGAGTGCAGAGGCTCTTTGG - Intergenic
1071193121 10:83125693-83125715 CTCTCCTTGAAGAGGTCCTTAGG - Intergenic
1072890025 10:99315804-99315826 GTGTCTGTGAAGATGCTGTTTGG - Intergenic
1076523988 10:131099287-131099309 CTGACAGAGAAGAGGTTCTGTGG - Intronic
1076573118 10:131445451-131445473 CTGTCTGTGCAGTGGTCCTGTGG - Intergenic
1078006010 11:7532750-7532772 CTGTCTTTAAAGAAATTCTTTGG + Intronic
1079473375 11:20802105-20802127 ATTTCTGTGAAGAGGGTCATTGG + Intronic
1080742326 11:35078101-35078123 TATTCTGTGAAGATGTTCTTGGG + Intergenic
1081673685 11:44956058-44956080 CTCACTGTGAAGAGGTCCTGGGG - Intergenic
1082211149 11:49503301-49503323 GTGTCTGTGAAGAATGTCTTGGG - Intergenic
1082592122 11:55024877-55024899 GTGTCTGTGAAGAGATACTTGGG - Intergenic
1082811026 11:57479113-57479135 CTGGCTGTGAGGAGGTTAATGGG + Intergenic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1084287025 11:68138643-68138665 TTGTCTGAGAAGAGGCACTTGGG + Intergenic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1086638497 11:89121758-89121780 GTGTCTGTGAAGAATGTCTTGGG + Intergenic
1087985945 11:104679696-104679718 CTGGGTGTGAAGAGTTGCTTTGG + Intergenic
1088130222 11:106479720-106479742 CTAACTGTGTAGATGTTCTTTGG + Intergenic
1088759780 11:112918504-112918526 CTTTCTGTGGAGACTTTCTTTGG - Intergenic
1091065020 11:132501545-132501567 CTGTCTGTGTACAGCTCCTTGGG - Intronic
1091077255 11:132631945-132631967 CCTTCTGTGAATAGGTCCTTAGG - Intronic
1095327963 12:40920847-40920869 CTGTCTTTGAAGAAGTTCACTGG - Intronic
1095553955 12:43477503-43477525 CTTTATGTTAAGGGGTTCTTTGG - Intronic
1096649031 12:53052984-53053006 CTGTCTCTGAAGAGGTCCCCTGG + Intronic
1097638091 12:62146149-62146171 GTTTCTGTGAAGAGGTTTCTTGG + Intronic
1098392568 12:69985054-69985076 CTGATTGTCAAGAAGTTCTTGGG + Intergenic
1100786105 12:98080247-98080269 CTGTCTGAGAATATTTTCTTAGG - Intergenic
1101364198 12:104056314-104056336 AGGTCTGAGAAGAGGTTCTGGGG - Intronic
1101882345 12:108634074-108634096 CTTTCTGGGGAGAAGTTCTTCGG + Intergenic
1101997466 12:109535292-109535314 CTGTCTGGGAAGAGGCGCTGTGG - Exonic
1102140713 12:110612906-110612928 TTGTCTTTAAATAGGTTCTTAGG + Intergenic
1104034477 12:125088994-125089016 TTGTCTGTGAAGTGGTTCCCAGG + Intronic
1106595520 13:31132163-31132185 GTGTCTGTGCAGAGGATGTTGGG + Intergenic
1108127880 13:47264230-47264252 CTGCCTTTGAACAGCTTCTTCGG + Intergenic
1113664612 13:112132473-112132495 CTGTCTGGGCAGATGTTATTTGG - Intergenic
1113697933 13:112361102-112361124 CTTTCTATGAAGAAGCTCTTCGG + Intergenic
1113865123 13:113516894-113516916 CTGGCAGTGATGAGCTTCTTAGG + Intronic
1114234427 14:20812219-20812241 CTGTCTCTGAGGAGGTTCCTTGG - Intergenic
1114258606 14:21022342-21022364 CTGTCTGGGAAGAGGCTGTGGGG - Intronic
1115455786 14:33600873-33600895 CTGTCTGGGAAAAGCTTCATGGG + Intronic
1115714313 14:36085851-36085873 CTGCCAGTGAAGAGGTTCAGAGG + Intergenic
1116513532 14:45777748-45777770 ATTTCTGTGAAGAGTGTCTTTGG + Intergenic
1117233711 14:53749392-53749414 TACTCTGTGAAGATGTTCTTTGG - Intergenic
1117383581 14:55189764-55189786 CTGTGTTTGGAGAGCTTCTTAGG - Intronic
1117916078 14:60679563-60679585 CTGTCAGTGGAGAGGTTTCTTGG + Intergenic
1118712738 14:68535904-68535926 TTGTGTGTGCTGAGGTTCTTTGG + Intronic
1120603000 14:86536037-86536059 ATGTATGTGAAGAGTTTGTTTGG + Intergenic
1120911333 14:89669508-89669530 CTCTCTGTGAAGAGGTTACTCGG - Intergenic
1123928458 15:25142716-25142738 CTCTTTGTGATTAGGTTCTTAGG + Intergenic
1124169793 15:27362435-27362457 CAGCCTGTGAAGATGTTCTTTGG + Intronic
1125969763 15:43902326-43902348 CTCTCTATGAAGATGTGCTTAGG + Intronic
1128491009 15:68144408-68144430 GTTTCTGTGAAGTGGTTCATGGG - Intronic
1131834710 15:96378705-96378727 CTGACGATGAAGTGGTTCTTTGG + Intergenic
1136392066 16:29971692-29971714 CTGTGGTTGAAGAGGTTCTCGGG - Intronic
1138622155 16:58220328-58220350 TTGTCTTTAAAGAAGTTCTTGGG - Intergenic
1140811107 16:78578852-78578874 CTGTCTGTGAACAGGTTAATGGG + Intronic
1144203125 17:12959045-12959067 GTGTCTGGGATGAGTTTCTTTGG + Intronic
1145056970 17:19709115-19709137 CCTTCTGTGAACAGGTCCTTGGG - Intronic
1145388962 17:22440449-22440471 CTGTCTGCGATGAGGGTCTGGGG - Intergenic
1148911021 17:50942813-50942835 CTGCCAGGGAAGAGGCTCTTAGG + Intergenic
1149828584 17:59851398-59851420 CTGTCTTTTCAGGGGTTCTTTGG - Intergenic
1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151846503 17:76659617-76659639 CTGTCTGAGAAGAGGGCCTCAGG - Intergenic
1155334068 18:24747142-24747164 CAGCCTGTGCAGAGGTTCTGAGG - Intergenic
1156288746 18:35725343-35725365 CTGTCTTACAAGAGGTCCTTAGG + Intergenic
1156733247 18:40222106-40222128 CTTTCTATGAAGAGGTTTATTGG - Intergenic
1157134310 18:45039067-45039089 CTGACTGTCCACAGGTTCTTGGG - Intronic
1157821293 18:50772220-50772242 CTGCCCTTGAACAGGTTCTTTGG - Intergenic
1158102997 18:53851904-53851926 CTTTCTATGAAGAGGTACCTAGG + Intergenic
1159556165 18:69947047-69947069 CTCTATGTGAAGAGGTGCTTTGG - Exonic
1159584423 18:70270101-70270123 ATGTCTGTGAAGGTGTTCCTGGG - Intergenic
1163765983 19:19163598-19163620 CTGTCTGTGAAGCAGTTGTTTGG - Intronic
1164002842 19:21120428-21120450 ATGTAAGTGGAGAGGTTCTTTGG + Exonic
1164360707 19:27505276-27505298 GTATCTGTGAAGTGATTCTTGGG + Intergenic
1164419897 19:28079758-28079780 TTGTCAGTGAAGAGGGGCTTGGG + Intergenic
1164576611 19:29408951-29408973 CTGGCTGTGTAGAGGTTCCCAGG + Intergenic
1165406495 19:35634074-35634096 CTGTCTGTGTGGAAGTTCCTGGG - Intronic
1166245270 19:41521208-41521230 CTGTATCTGAGTAGGTTCTTCGG + Intergenic
1166274219 19:41740639-41740661 TTGTCTTTGAAGAGGTTTTCAGG + Intronic
1166646589 19:44536560-44536582 GTGTGTGTGTAGGGGTTCTTGGG - Intergenic
1167035317 19:46991811-46991833 CAGTCTGGGAAGAGCTACTTTGG - Intronic
926709267 2:15864135-15864157 GTGTGTGTGAAGAAGTTCTAGGG + Intergenic
932012619 2:67993519-67993541 CTGTCTGAGAAGGGCTTCTGAGG - Intergenic
932297921 2:70642169-70642191 CTGTCAATGCAGTGGTTCTTAGG + Intronic
936910329 2:117584294-117584316 CTGTCTGTGAAGAAAGTCATTGG - Intergenic
938197449 2:129341652-129341674 CTCTTTGTGAAGAGCTTCTTGGG - Intergenic
939567000 2:143797014-143797036 TTGTCTGTGAAGTGGAACTTGGG - Intergenic
942683191 2:178501118-178501140 CTGTATCTGAGTAGGTTCTTCGG - Exonic
946669905 2:222091433-222091455 CTTTCTGTGAAAAGGTTCTCCGG - Intergenic
947563160 2:231175812-231175834 CTGTTTGTGCAGAGATTCTTTGG + Intergenic
1169119152 20:3084881-3084903 CTGTCTGTGCAGGGGATCATAGG + Intergenic
1169736207 20:8840175-8840197 CAGTCTGTGAAGCAGTACTTAGG - Intronic
1170516434 20:17135146-17135168 ATTTCTGTGAAGATGTTTTTGGG - Intergenic
1172865942 20:38097367-38097389 GTTTCTGTGAAGATGTTTTTGGG - Intronic
1176269828 20:64230594-64230616 CTGGCTGGGAAGAGGCTCTGTGG - Intronic
1177931912 21:27295833-27295855 CTACCTGTGATGAGGTTTTTGGG - Intergenic
1179948296 21:44695344-44695366 AGGTCTGAGAAGAGGTGCTTTGG - Intronic
1179980899 21:44895215-44895237 ATGTGTGGTAAGAGGTTCTTGGG + Intronic
1180929063 22:19576730-19576752 CTGTCAGTGATGAGCTTCTCTGG + Intergenic
1181795000 22:25301473-25301495 CTGTCTGTGAAGAGGGTCTTTGG + Intergenic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
1182455168 22:30445685-30445707 CTGACTGTGTAGAGGGTCATAGG - Intergenic
949498139 3:4652995-4653017 ATGTCTGTGAAGAGTTTTTGAGG + Intronic
950032437 3:9861851-9861873 CTGTCTGTGCAAAGGTTGTGAGG + Intergenic
950527612 3:13533536-13533558 CTGGCTGAGGAGAGGATCTTGGG + Intergenic
950866510 3:16193987-16194009 CTGTCTGTGAACAGGGTGCTTGG - Intronic
951650796 3:24949312-24949334 CTGTCTCAGAGGAGGTCCTTGGG - Intergenic
952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG + Intergenic
952577770 3:34795297-34795319 CTGCCTGAGAAGATGTTCCTGGG - Intergenic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955873389 3:63463553-63463575 CTGTCAGAGCAGAAGTTCTTAGG + Intronic
956400523 3:68874632-68874654 CTGTCTTTGAAGAGTTCCTCGGG - Intronic
956691307 3:71880311-71880333 CTGTCTATGAAGTAGTTCTCTGG - Intergenic
958427564 3:93996815-93996837 CTGTCTGTGGGCTGGTTCTTAGG + Intronic
958579104 3:95992959-95992981 GTTTCCTTGAAGAGGTTCTTGGG - Intergenic
959592265 3:108093156-108093178 CTGTATGTAAGGAGTTTCTTGGG + Intergenic
960478678 3:118161765-118161787 ATGTCTGTGCAGATTTTCTTTGG + Intergenic
961435699 3:126915117-126915139 CTGACTGTGGAGGGGTTTTTAGG + Intronic
961487672 3:127227922-127227944 CAGGCTGTGAAGGGTTTCTTGGG + Intergenic
964230214 3:154457475-154457497 CTGTCTGTGAGTAGTTTATTTGG + Intergenic
965001901 3:162964961-162964983 CTTTCTGTTAAAAGGTTGTTAGG + Intergenic
965535135 3:169815160-169815182 ATTTCTGTGAAGAAGGTCTTTGG + Intergenic
966128115 3:176604079-176604101 TTCTTTCTGAAGAGGTTCTTTGG - Intergenic
967441354 3:189512811-189512833 CTCTCTGTGAATAGTCTCTTTGG + Intergenic
967527164 3:190508327-190508349 CTATTTGTGTAGAGGTTGTTTGG - Intergenic
967829824 3:193909382-193909404 CTGTCTTTGCAGGGGTTCCTGGG + Intergenic
969555497 4:7906067-7906089 CTGTTTGGAGAGAGGTTCTTGGG - Intronic
970041330 4:11800200-11800222 CAGTCTGTGAAATGCTTCTTGGG + Intergenic
970284187 4:14491045-14491067 TTGTCTCTGAAGAGTTTCTGTGG - Intergenic
971415215 4:26420611-26420633 TTGTCTGTAAAGATGTTCTATGG + Exonic
972639912 4:40915973-40915995 CTGTCTTTAAAGAGTTTCTTTGG + Intronic
973025062 4:45258810-45258832 CTGTCAATGAAGAAGTTCTTAGG + Intergenic
973056734 4:45668819-45668841 CTGACTGTGTAGAGGCTCTAAGG + Intergenic
973552905 4:52052792-52052814 CTGCCTGTTATGAGGTCCTTAGG + Intronic
974129176 4:57731531-57731553 CTGTGTGCAAAGAGGTTGTTTGG - Intergenic
974205774 4:58701461-58701483 CTTTCTGAGAAGCAGTTCTTAGG + Intergenic
976688939 4:87847256-87847278 CTTTCAGTGTAGAGGTTTTTTGG + Intergenic
980555775 4:134402166-134402188 ATGTCTGTGAAGATGATCATAGG + Intergenic
981679268 4:147376474-147376496 CTGTCTGAGGAGGTGTTCTTAGG - Intergenic
982101419 4:151971885-151971907 CTGCCTCTGATGAGGGTCTTAGG - Intergenic
982476493 4:155858191-155858213 CTGTTTGTGACTTGGTTCTTTGG - Intronic
982541164 4:156673506-156673528 CTCTCTATGAATATGTTCTTTGG + Intergenic
984013518 4:174400279-174400301 CTCTCTGGAAAGAGATTCTTTGG - Intergenic
985335881 4:188893526-188893548 CTGTCTGTGAAGAATGTCATTGG + Intergenic
985940488 5:3131960-3131982 ATGTGTGTGAACAGATTCTTAGG - Intergenic
986818451 5:11438403-11438425 CTGTCTGGGAAGCAGTTGTTAGG + Intronic
988058868 5:26139717-26139739 CTGTCTGTGAAGTGGAGCCTGGG - Intergenic
988439043 5:31211069-31211091 CTGTGTGTGAAGTGGGTTTTTGG + Intronic
993968281 5:94385530-94385552 TTGTCTGTCAAGAGGTTTCTGGG + Intronic
994786856 5:104177275-104177297 CTGTCTGTAAAGAGGTTAAGCGG + Intergenic
995610362 5:113903166-113903188 CTGTCTTAGAAGAGCATCTTGGG + Intergenic
995636637 5:114201039-114201061 CTGTGTGTGAGTGGGTTCTTAGG + Intergenic
995732153 5:115257120-115257142 TTGTCTGTGAATTGATTCTTTGG - Intronic
996372829 5:122771471-122771493 GTTTCTGTGAAGATGTTTTTTGG - Intergenic
997414567 5:133715483-133715505 CTGTCTGTGCAAATGTTCTTGGG - Intergenic
997483269 5:134206054-134206076 CTGTCTGTGGAGATGTGCATGGG - Exonic
1000100304 5:158009863-158009885 CTGTTTGAGAATAGGCTCTTCGG - Intergenic
1001129480 5:169052073-169052095 ATTTCTGTGAAGAAGTTCTCTGG - Intronic
1001863179 5:175078171-175078193 CTTTCTGTGTTAAGGTTCTTAGG - Intergenic
1002573555 5:180158378-180158400 CTTTTTGAGAAGAGGTGCTTAGG + Intronic
1004171492 6:13298916-13298938 CTTCCTGAGAAGAGGTTTTTAGG - Intronic
1004538961 6:16530947-16530969 CTGTCTTTGAAGAGTTTATATGG - Intronic
1005757584 6:28939012-28939034 CTTTCTGAGAAAAGGTACTTGGG + Intergenic
1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG + Intronic
1007713221 6:43838070-43838092 CTGGCCCTGAAGAGGATCTTTGG + Intergenic
1008049274 6:46883524-46883546 TTGTTAGTTAAGAGGTTCTTGGG + Intronic
1008799705 6:55351484-55351506 CTTGCTGTGAAGAGCTTCTTTGG - Exonic
1010379257 6:75206952-75206974 CTGTGTGTGGAGGGGTGCTTTGG - Intergenic
1011381528 6:86746842-86746864 TTGACTTTGAAGAAGTTCTTTGG - Intergenic
1013844190 6:114429368-114429390 CTGTCTTTGAAGATTTCCTTTGG + Intergenic
1015053514 6:128871442-128871464 CTATCAGTGCAGAGGTTGTTTGG - Intergenic
1015620791 6:135129674-135129696 GTGTCTTTGAATAGGTTCCTTGG - Intergenic
1016621445 6:146113859-146113881 CTGTTTGGGGAGAGGTTCTTTGG + Intronic
1018450896 6:163906399-163906421 CAGTCTGTTAAGAGGTCCTGGGG + Intergenic
1018728405 6:166630965-166630987 CTGTCAGGGAAGGGCTTCTTGGG + Intronic
1020505640 7:8984042-8984064 ATGCCTGTGAAAAGGTTATTTGG - Intergenic
1021485268 7:21160940-21160962 CTCTCAGTGAAGAGCTTCTTAGG + Intergenic
1022613833 7:31907786-31907808 TTCTCTGTGCAGAAGTTCTTTGG + Intronic
1025283176 7:57642856-57642878 CTGTCTGGTAAGAGGAACTTGGG + Intergenic
1028069681 7:86435898-86435920 CTGTTTGTGAACAGAATCTTGGG - Intergenic
1028299184 7:89175595-89175617 ATTTCTGTGAAGAAGTTCATTGG + Intronic
1031426853 7:121615674-121615696 CAGTCTGTAAAGAGGGCCTTAGG - Intergenic
1031851596 7:126870999-126871021 CTGTATGTAAAGAAGTTCTAAGG + Intronic
1032074129 7:128828368-128828390 CTGCCTGTGACGAGGTGCTCAGG - Intergenic
1034295548 7:149968911-149968933 CCCTCTGTGGAGACGTTCTTGGG + Intergenic
1034810511 7:154128019-154128041 CCCTCTGTGGAGACGTTCTTGGG - Intronic
1035349217 7:158233591-158233613 CTTTCTGTGAAGAGTGTCATTGG - Intronic
1035929766 8:3767151-3767173 CTGTCTGTGCTGTGCTTCTTAGG + Intronic
1036185796 8:6621670-6621692 CTGTCTGAGAAATGGGTCTTAGG + Exonic
1036747965 8:11423625-11423647 GTGGCAGTGAAGAGGCTCTTTGG + Exonic
1037302821 8:17470681-17470703 TTGTGTGTGAAGATGTTCTCTGG - Intergenic
1038220477 8:25602607-25602629 CTGTCTTGGAATAGGTTCATAGG + Intergenic
1040411255 8:47156877-47156899 CTTTCTGTGCAGAAGCTCTTTGG - Intergenic
1042143604 8:65704583-65704605 CAGCCTGAAAAGAGGTTCTTGGG + Intronic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1045495070 8:102701085-102701107 CTGTCTGGGAAGTGGGTTTTGGG - Intergenic
1045523348 8:102922145-102922167 CTGTCTGTGAAAAGGTTCAAGGG - Intronic
1048136090 8:131747726-131747748 CTGTATTTTAAGATGTTCTTTGG - Intergenic
1048151167 8:131896150-131896172 CTGTCTGTGGTGAAGATCTTGGG + Intergenic
1048694081 8:137004615-137004637 CAATCTGTGAATAAGTTCTTAGG - Intergenic
1050779866 9:9319786-9319808 CTGTTTGTTATGAGGTTCCTTGG - Intronic
1051557812 9:18404600-18404622 CTGTTTGTGAAAAGATGCTTAGG - Intergenic
1052671063 9:31557879-31557901 GTGACTGTTAAGAGGTTATTAGG + Intergenic
1055029264 9:71756446-71756468 CTGTAGTTGAAGAGATTCTTTGG - Intronic
1056962515 9:91138660-91138682 CTTTTTGTGAAGAGGTGCTCAGG + Intergenic
1057078254 9:92152319-92152341 CTGACAGAGAAGAGGTTCTGTGG - Intergenic
1059463674 9:114451683-114451705 CTCTTTGTGAAGTGGTTCTCAGG - Intronic
1059516603 9:114901742-114901764 CTTTCTGTGAGTAGATTCTTTGG - Intronic
1062700667 9:137900140-137900162 CCGTCTGTGAGGAGCTTCTGGGG - Intronic
1188831565 X:34904504-34904526 CTTTCTGTGAAGAGCATCATTGG - Intergenic
1188929355 X:36087365-36087387 ATTTCTGTAAAGAGATTCTTTGG + Intronic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1189900165 X:45698300-45698322 TTGTCTCTGAAGAGATGCTTGGG + Intergenic
1190371632 X:49748182-49748204 GTGTGTGTAAAGAGGTTCTGTGG - Intergenic
1192452285 X:71252003-71252025 CAGGCTGTGACGAGGGTCTTAGG - Intronic
1193159444 X:78211627-78211649 ATGTCTGTGAAGAATGTCTTTGG + Intergenic
1198464930 X:136896555-136896577 CAGTCTTTGAAGAGGTAATTAGG - Intergenic
1201309823 Y:12586870-12586892 CTGTTTCTGAATAGGTTATTTGG + Intergenic
1201939961 Y:19448780-19448802 CTGGTAGTGAAGAGGCTCTTGGG - Intergenic