ID: 1181836453

View in Genome Browser
Species Human (GRCh38)
Location 22:25613984-25614006
Sequence GGGTGGGGCGATGATAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181836453_1181836459 10 Left 1181836453 22:25613984-25614006 CCATAATTATCATCGCCCCACCC 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1181836459 22:25614017-25614039 TCAGAAAAGCTACATTTTACTGG 0: 1
1: 1
2: 1
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181836453 Original CRISPR GGGTGGGGCGATGATAATTA TGG (reversed) Intronic
900325819 1:2108183-2108205 GGGTGGGGCCATGATCCTTCTGG + Intronic
906189325 1:43885696-43885718 GGGTGGGGTGATGGTAAAGATGG - Intronic
912414593 1:109499304-109499326 GGGTGGGACGATGAGAAAGAAGG - Intronic
915301679 1:154955235-154955257 GGATGGGGAGATGATAACAAGGG - Intronic
920185855 1:204159019-204159041 GGTGGGGGCGATGGTAAATAAGG - Intronic
920704303 1:208240596-208240618 GGGTGGGGCGGTGGTGATTGGGG + Intronic
924124499 1:240836148-240836170 GGGTGGGGGGTTGATAATGGGGG + Intronic
1064563207 10:16613072-16613094 GGGAGAGGCGATGATGATTTTGG - Intronic
1069575809 10:69527830-69527852 GGGTGGGGATAGGAAAATTAGGG + Intergenic
1084545771 11:69814381-69814403 TGGTGGGGCGATGATTAAGATGG + Intronic
1085753725 11:79186600-79186622 GGGTGGTGCGATGATAAACTAGG + Intronic
1093108321 12:15116896-15116918 GGGTGGGGGGATGATTATTTAGG + Intronic
1095817375 12:46439582-46439604 TGGTGTGGCCATGATAATTTTGG + Intergenic
1096591641 12:52663939-52663961 GGGTGGGTTGATGGTAATTTGGG - Intergenic
1101867351 12:108530141-108530163 GAGTGGGGCGATGATGAAGAAGG - Exonic
1102516584 12:113452809-113452831 GGGTTGGGGGATGATATTTCCGG - Intergenic
1106537376 13:30659146-30659168 TGGTGGGGCTACAATAATTATGG - Exonic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1109370816 13:61417053-61417075 GGGTGGGGTGATGGTGATTGGGG - Intronic
1109887598 13:68562441-68562463 GGATGGGGCGATGACATTTATGG + Intergenic
1118069937 14:62235366-62235388 GGGTGGGGGGAGGATAAGGAGGG - Intergenic
1120652130 14:87147442-87147464 AGGTGGTCAGATGATAATTATGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121317732 14:92972058-92972080 GTGTGTGGAGATGATGATTATGG - Intronic
1133401126 16:5487948-5487970 TGGTGGGGAGAAGATGATTATGG + Intergenic
1133908292 16:10041333-10041355 GGGTGTGGGCTTGATAATTAAGG + Intronic
1138550036 16:57742691-57742713 GGGTGTGGCTAAGCTAATTACGG - Intronic
1141775694 16:86121531-86121553 AGGTGGGGGGATGATGATGAGGG - Intergenic
1144468177 17:15513782-15513804 CGGTGGGGTGGTGATAGTTAGGG - Intronic
1153084796 18:1271976-1271998 GGGTGTGGCCATCATCATTAGGG + Intergenic
1153907208 18:9672882-9672904 GGGTAGGGAGATCATAACTAGGG - Intergenic
1154981503 18:21506013-21506035 GGGTGGAGGGATGAAAAATAAGG + Intronic
1159923497 18:74247034-74247056 GGGTGGGGAGATGACAATGGGGG - Intergenic
1160966080 19:1747533-1747555 GGGTGGGGGGATTATACTAAGGG + Intergenic
1163775891 19:19217326-19217348 GGGTGGAGCGATGGAAATAAAGG + Intronic
1166398820 19:42462752-42462774 GGGTGGGGCTAGGTTGATTAGGG + Intergenic
1167482890 19:49744127-49744149 GGGTGGGGCGCTGTTCATTTTGG - Intronic
1168300590 19:55402637-55402659 GGGTGCAGTGATGAGAATTAGGG - Intronic
927731235 2:25473788-25473810 GGGTGGGGCGAGGAAAAGTGAGG - Intronic
937048768 2:118870902-118870924 GGTTGGGGCCATTATAAATAAGG + Intergenic
937430701 2:121835769-121835791 GGGTGGGGAGATGGAAAGTATGG + Intergenic
939941083 2:148352217-148352239 AGGTGGGGTGATGGTAATTCAGG - Intronic
941762421 2:169259623-169259645 GGGTTGGGCGATGATACCTCAGG - Intronic
942496079 2:176541205-176541227 GGATGGGGTGATGAAAATTAAGG + Intergenic
944014625 2:195020284-195020306 GGGTGGGGGGATGATCAAGAAGG + Intergenic
947383070 2:229563824-229563846 TGGTGGGGTGATGATGATGATGG - Intronic
1171291114 20:23983644-23983666 GGAAGGGGCGATGAGAATGAAGG + Intergenic
1173334175 20:42099589-42099611 GGGTGGGGAGAAAATAAATAGGG - Intronic
1175243353 20:57565901-57565923 CGGTGTGGTGATGATTATTATGG - Exonic
1179347707 21:40576401-40576423 GGCTGGGACACTGATAATTATGG + Intronic
1180766293 22:18347449-18347471 GGAAGGGGCGATGAGAATGAAGG - Intergenic
1180780020 22:18514929-18514951 GGAAGGGGCGATGAGAATGAAGG + Intergenic
1180812736 22:18772250-18772272 GGAAGGGGCGATGAGAATGAAGG + Intergenic
1181648543 22:24246613-24246635 GGAAGGGGCGATGAGAATGAAGG + Intergenic
1181702827 22:24630389-24630411 GGAAGGGGCGATGAGAATGAAGG - Intergenic
1181836453 22:25613984-25614006 GGGTGGGGCGATGATAATTATGG - Intronic
1183705681 22:39473804-39473826 GGGTGGGGGGATGGAAGTTAAGG + Intronic
953154720 3:40359297-40359319 GGGTGGGGAAGTGATTATTATGG - Intergenic
956555830 3:70521419-70521441 GGCTGGGGCAATTATGATTATGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
985983070 5:3488447-3488469 GGGAGGGGGGATGATAAAAAGGG - Intergenic
990241023 5:53816816-53816838 GGGTGGGGTGAGGATTATAATGG + Intergenic
1000042280 5:157493614-157493636 GGGTGGGGCAGTGTGAATTAAGG - Intronic
1000997656 5:167974752-167974774 GGATGGGGCGATGGTTAATAAGG - Intronic
1003539175 6:7003104-7003126 GGGTTGGGTGATGCTAATCAAGG - Intergenic
1005758262 6:28944880-28944902 GGGAGGGGAGATGAGAATTTTGG - Intergenic
1006017848 6:31096525-31096547 GGGAGGAGGAATGATAATTATGG + Intergenic
1006162999 6:32048847-32048869 AGTTGGGGTGATGATAATAATGG - Intronic
1006677905 6:35777137-35777159 GGGTTGGGGGATGAGAATGAAGG - Intronic
1008355387 6:50546882-50546904 GGGTGGTACGAAGATAAGTAAGG - Intergenic
1008380885 6:50838733-50838755 GGGTTTGGGGATGATATTTATGG + Intronic
1013157663 6:107508881-107508903 GGGAGGGGAGATGATGATGAAGG + Intronic
1016298179 6:142599087-142599109 GGGTGGGGAGGGGAGAATTAGGG - Intergenic
1016312125 6:142745551-142745573 GGGAGGAGGGATGATAAATAGGG + Intergenic
1023287508 7:38634114-38634136 GGGTGGGGTGGGAATAATTACGG - Intergenic
1023465982 7:40455544-40455566 GAGTGGGGCTATATTAATTATGG + Intronic
1024982691 7:55170790-55170812 GACTGGGGCCATGCTAATTACGG - Intronic
1025922639 7:65927882-65927904 GGGTGGGGAGAGGGTAGTTAAGG + Intronic
1029202760 7:98849980-98850002 GGCTGGGCCGATGATAGTTTTGG + Intronic
1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG + Intronic
1030291612 7:107878451-107878473 AGGTGGGGAGATGGTAAGTAAGG - Intergenic
1033020036 7:137715315-137715337 AGGTCTGGGGATGATAATTAAGG - Intronic
1033230808 7:139595963-139595985 GGGTGGGGCCATGAGATTTTGGG + Intronic
1055521760 9:77088521-77088543 GAATGGGGAGATGATAATCAAGG - Intergenic
1060934198 9:127506268-127506290 GGGTGGAGAGATGAGATTTAGGG - Exonic
1061211342 9:129195232-129195254 GGGTGGGGGGTTGATAAATCTGG - Intergenic
1061247915 9:129410645-129410667 GGATAGGGTGATGATAATGATGG - Intergenic
1061318356 9:129812158-129812180 GGGTGGGGTGATGGTGATGAGGG - Intergenic
1190120916 X:47658760-47658782 GGGTGGGGCGTTCAAAGTTAGGG - Intronic
1197407040 X:126065663-126065685 GGGTGGGGGGATGGTGTTTATGG - Intergenic
1198766877 X:140089415-140089437 TAGTGGGGTGATAATAATTAGGG + Intergenic