ID: 1181842066

View in Genome Browser
Species Human (GRCh38)
Location 22:25671686-25671708
Sequence CTGGCTGTAGAGTCTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1056
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 1028}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181842062_1181842066 9 Left 1181842062 22:25671654-25671676 CCTCAGCTATAAAATGGGGATCA 0: 1
1: 14
2: 218
3: 1471
4: 4788
Right 1181842066 22:25671686-25671708 CTGGCTGTAGAGTCTGTAGGAGG 0: 1
1: 0
2: 0
3: 27
4: 1028
1181842058_1181842066 18 Left 1181842058 22:25671645-25671667 CCTTGGTCTCCTCAGCTATAAAA 0: 1
1: 5
2: 74
3: 523
4: 2699
Right 1181842066 22:25671686-25671708 CTGGCTGTAGAGTCTGTAGGAGG 0: 1
1: 0
2: 0
3: 27
4: 1028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181842066 Original CRISPR CTGGCTGTAGAGTCTGTAGG AGG Intronic
900635886 1:3664730-3664752 GGGGTTGTAGAGTCTGTGGGAGG + Intronic
900784367 1:4638476-4638498 CTTGCTGTAGGGCCTGCAGGAGG - Intergenic
900880970 1:5381103-5381125 CAGGCTGTGGAGACTGCAGGGGG - Intergenic
903851425 1:26308841-26308863 CTGGCTGTAGATTCCGCAGCAGG + Intronic
904442358 1:30540004-30540026 CCGGCTGCAGAGCCTGAAGGTGG + Intergenic
905139980 1:35835600-35835622 CTGGCTGCAGGGCCTGCAGGAGG + Intronic
905474727 1:38217927-38217949 CAGGCTGTTGATTCTGCAGGAGG + Intergenic
905549012 1:38821287-38821309 CTAGCTGTAGATTCTGGAGGTGG - Intergenic
907481953 1:54751073-54751095 CTGACTCCAGAGTCTGTAGCTGG + Intergenic
908583176 1:65539714-65539736 CTGCCTGTAGAGTGTGAAGTAGG + Intronic
913733433 1:121743206-121743228 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913733506 1:121744565-121744587 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913733654 1:121747283-121747305 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913734367 1:121759615-121759637 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913735207 1:121774908-121774930 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913735279 1:121776267-121776289 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913739193 1:121821459-121821481 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913744962 1:121892537-121892559 CTGTTTGTAGACTCTGCAGGTGG - Intergenic
913760684 1:122129566-122129588 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913767103 1:122204078-122204100 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913768714 1:122222753-122222775 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913789949 1:122507756-122507778 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913790048 1:122509456-122509478 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913790161 1:122511495-122511517 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913790377 1:122515237-122515259 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913790397 1:122515576-122515598 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913790422 1:122515916-122515938 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913791102 1:122528161-122528183 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913791211 1:122530201-122530223 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913791365 1:122532922-122532944 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913791591 1:122536999-122537021 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913791971 1:122544140-122544162 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913792764 1:122558420-122558442 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913792929 1:122561479-122561501 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913793551 1:122572703-122572725 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913793889 1:122578486-122578508 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913793964 1:122579845-122579867 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913794707 1:122593106-122593128 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913794996 1:122598211-122598233 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913795229 1:122602291-122602313 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913795427 1:122605689-122605711 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913795558 1:122608069-122608091 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913795582 1:122608409-122608431 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913795910 1:122614192-122614214 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913796249 1:122620311-122620333 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913796399 1:122623026-122623048 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913796936 1:122632539-122632561 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913797089 1:122635259-122635281 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913798942 1:122668576-122668598 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913799220 1:122673680-122673702 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913799570 1:122680142-122680164 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913799647 1:122681501-122681523 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913800366 1:122694425-122694447 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913800461 1:122696124-122696146 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913800948 1:122704958-122704980 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913801259 1:122710739-122710761 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913801279 1:122711078-122711100 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913801430 1:122713791-122713813 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913801601 1:122716854-122716876 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913801658 1:122717872-122717894 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913801830 1:122720931-122720953 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913802151 1:122726708-122726730 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913802284 1:122729087-122729109 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913803168 1:122745068-122745090 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913803900 1:122758327-122758349 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913803951 1:122759345-122759367 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913804248 1:122764784-122764806 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913805225 1:122782471-122782493 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913805378 1:122785189-122785211 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913805453 1:122786549-122786571 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913805737 1:122791651-122791673 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913805789 1:122792670-122792692 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913805831 1:122793351-122793373 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913805851 1:122793691-122793713 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913806024 1:122796749-122796771 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913806409 1:122803549-122803571 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913806782 1:122810347-122810369 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913807038 1:122814765-122814787 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913807285 1:122819186-122819208 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913807340 1:122820206-122820228 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913807807 1:122828719-122828741 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913807877 1:122830078-122830100 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913808214 1:122836194-122836216 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913808330 1:122838234-122838256 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913808947 1:122849458-122849480 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913809140 1:122852858-122852880 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913809242 1:122854558-122854580 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913809603 1:122861013-122861035 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913809622 1:122861352-122861374 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913809785 1:122864413-122864435 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913809902 1:122866451-122866473 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913810109 1:122870191-122870213 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913810294 1:122873589-122873611 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913810810 1:122882764-122882786 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913811213 1:122889904-122889926 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913811383 1:122892965-122892987 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913811535 1:122895684-122895706 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913811627 1:122897382-122897404 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913811996 1:122903844-122903866 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913812358 1:122910304-122910326 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913812664 1:122915744-122915766 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913812830 1:122918805-122918827 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913813266 1:122926629-122926651 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913813395 1:122929009-122929031 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913813694 1:122934448-122934470 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913813805 1:122936489-122936511 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913813959 1:122939210-122939232 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913813996 1:122939889-122939911 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913814019 1:122940229-122940251 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814159 1:122942950-122942972 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814334 1:122946013-122946035 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814509 1:122949073-122949095 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814565 1:122950092-122950114 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814767 1:122953830-122953852 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814829 1:122954847-122954869 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913814908 1:122956204-122956226 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913815265 1:122962664-122962686 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913815325 1:122963684-122963706 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913815678 1:122969803-122969825 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913816080 1:122976940-122976962 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913816439 1:122983064-122983086 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913816622 1:122986461-122986483 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913816731 1:122988499-122988521 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913816791 1:122989518-122989540 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913816957 1:122992577-122992599 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817018 1:122993598-122993620 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817092 1:122994957-122994979 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817377 1:123000046-123000068 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817395 1:123000385-123000407 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913817669 1:123005143-123005165 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817729 1:123006161-123006183 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817806 1:123007522-123007544 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913817977 1:123010585-123010607 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913818303 1:123016360-123016382 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818362 1:123017379-123017401 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818420 1:123018398-123018420 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818679 1:123022814-123022836 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818736 1:123023833-123023855 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818847 1:123025871-123025893 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818908 1:123026891-123026913 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913818963 1:123027906-123027928 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913819113 1:123030625-123030647 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913819229 1:123032665-123032687 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913819396 1:123035722-123035744 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913819806 1:123043198-123043220 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913820539 1:123056125-123056147 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913820634 1:123057823-123057845 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913820966 1:123063942-123063964 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913821430 1:123072436-123072458 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913821463 1:123073115-123073137 CTGTCTGTAAAGTCTGCACGTGG + Intergenic
913822020 1:123082970-123082992 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913822134 1:123085012-123085034 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913822247 1:123087050-123087072 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913822573 1:123092827-123092849 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913822630 1:123093846-123093868 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913822829 1:123097247-123097269 CTGATTGTAAAGTCTGTAAGTGG + Intergenic
913823173 1:123103538-123103560 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913823512 1:123109654-123109676 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913823570 1:123110674-123110696 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913823857 1:123116108-123116130 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913823961 1:123118148-123118170 CTGTTTGTAAAGTCTGTAAGAGG + Intergenic
913824017 1:123119167-123119189 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913824125 1:123121207-123121229 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913824262 1:123123587-123123609 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913824378 1:123125626-123125648 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913824527 1:123128343-123128365 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913824817 1:123133443-123133465 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913824935 1:123135484-123135506 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913825732 1:123149758-123149780 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913826110 1:123156221-123156243 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913826169 1:123157241-123157263 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913826332 1:123160303-123160325 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913826559 1:123164383-123164405 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913826672 1:123166422-123166444 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913826689 1:123166761-123166783 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913826793 1:123168466-123168488 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913826888 1:123170168-123170190 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913827160 1:123174925-123174947 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913827449 1:123180026-123180048 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913827557 1:123182068-123182090 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913827811 1:123186830-123186852 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913828339 1:123196348-123196370 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913828398 1:123197368-123197390 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913828458 1:123198388-123198410 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913828756 1:123203822-123203844 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913828930 1:123206884-123206906 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913829155 1:123210965-123210987 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913829326 1:123214024-123214046 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913829742 1:123221805-123221827 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913829933 1:123225203-123225225 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913830007 1:123226565-123226587 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913830185 1:123229624-123229646 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913830560 1:123236758-123236780 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913830748 1:123240156-123240178 CTGTTTGTAGAGTCTGCAAGTGG + Intergenic
913830846 1:123241856-123241878 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913830925 1:123243215-123243237 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913830964 1:123243894-123243916 CTGTCTGTAAAGTCTGCACGTGG + Intergenic
913830984 1:123244234-123244256 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913831139 1:123246951-123246973 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913831275 1:123249327-123249349 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913831382 1:123251370-123251392 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913831870 1:123260371-123260393 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
913832431 1:123270238-123270260 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913832528 1:123271936-123271958 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913833073 1:123281446-123281468 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913833254 1:123284844-123284866 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913833474 1:123288583-123288605 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913833533 1:123289602-123289624 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913833585 1:123290622-123290644 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913833933 1:123296741-123296763 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913834217 1:123301840-123301862 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913834939 1:123314587-123314609 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913835126 1:123317992-123318014 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913835444 1:123323773-123323795 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913835465 1:123324113-123324135 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913835587 1:123326152-123326174 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913835682 1:123327855-123327877 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913835820 1:123330233-123330255 CTGTTTGTAAAGTCTGTATGTGG + Intergenic
913836128 1:123335669-123335691 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913836147 1:123336007-123336029 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913836299 1:123338725-123338747 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913836472 1:123341786-123341808 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913836587 1:123343825-123343847 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913836694 1:123345863-123345885 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913836864 1:123348922-123348944 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913837058 1:123352320-123352342 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913837090 1:123352999-123353021 CTGTCTGTAAAGTCTGCACGTGG + Intergenic
913837107 1:123353339-123353361 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913837281 1:123356396-123356418 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913837398 1:123358430-123358452 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913837685 1:123363530-123363552 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913837916 1:123367609-123367631 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913838101 1:123371005-123371027 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913838282 1:123374064-123374086 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913838417 1:123376444-123376466 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913838525 1:123378483-123378505 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913839148 1:123389686-123389708 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913839324 1:123392745-123392767 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913839380 1:123393765-123393787 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913840058 1:123406009-123406031 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913840264 1:123409746-123409768 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913840395 1:123412120-123412142 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913840411 1:123412459-123412481 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913840568 1:123415179-123415201 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913840675 1:123417217-123417239 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913840949 1:123421977-123421999 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913841111 1:123424698-123424720 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913841447 1:123430479-123430501 CTGTCTGTAAAGTCTGCACGTGG + Intergenic
913841546 1:123432179-123432201 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913841770 1:123436255-123436277 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913842482 1:123449168-123449190 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913842504 1:123449508-123449530 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913842832 1:123455458-123455480 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913842890 1:123456478-123456500 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913842942 1:123457498-123457520 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913843173 1:123461568-123461590 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913843231 1:123462587-123462609 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913843312 1:123464286-123464308 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913843390 1:123465644-123465666 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913843448 1:123466664-123466686 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913843812 1:123473129-123473151 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913844141 1:123479243-123479265 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913844255 1:123481281-123481303 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913844374 1:123483322-123483344 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913844468 1:123485021-123485043 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913844546 1:123486381-123486403 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913844710 1:123489442-123489464 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913845052 1:123495558-123495580 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913845166 1:123497600-123497622 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913845493 1:123503717-123503739 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913845644 1:123506437-123506459 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913845739 1:123508137-123508159 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913846005 1:123512897-123512919 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913846234 1:123516975-123516997 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913846403 1:123520037-123520059 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913846459 1:123521056-123521078 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913847030 1:123531593-123531615 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913847694 1:123543491-123543513 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913847749 1:123544511-123544533 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913847954 1:123548239-123548261 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913848225 1:123553002-123553024 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913848433 1:123557080-123557102 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913848566 1:123559460-123559482 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913848755 1:123562861-123562883 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913848777 1:123563201-123563223 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913848891 1:123565239-123565261 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913849056 1:123568293-123568315 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913849286 1:123572376-123572398 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913849344 1:123573395-123573417 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913849671 1:123579168-123579190 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913849693 1:123579508-123579530 CTGTTTGTAAAGTCTGTATGTGG + Intergenic
913849804 1:123581545-123581567 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913849920 1:123583586-123583608 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913850033 1:123585627-123585649 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913850142 1:123587661-123587683 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913850626 1:123596164-123596186 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913850906 1:123601262-123601284 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913851253 1:123607382-123607404 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913851484 1:123611460-123611482 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913851662 1:123614519-123614541 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913851827 1:123617581-123617603 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913851994 1:123620639-123620661 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913852272 1:123625736-123625758 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913852332 1:123626756-123626778 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913852573 1:123631173-123631195 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913852856 1:123636269-123636291 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913852969 1:123638307-123638329 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913853938 1:123655655-123655677 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913854017 1:123657014-123657036 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913854135 1:123659054-123659076 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913854242 1:123661092-123661114 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913854318 1:123662450-123662472 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913854418 1:123664149-123664171 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913854636 1:123668231-123668253 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913854988 1:123674687-123674709 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913855328 1:123680808-123680830 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913855443 1:123682847-123682869 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913855504 1:123683868-123683890 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913855616 1:123685909-123685931 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913856072 1:123694404-123694426 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913856145 1:123695762-123695784 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913856319 1:123698823-123698845 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913856607 1:123703924-123703946 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913856738 1:123706303-123706325 CTGTTTGTAGTGTCTGTAAGTGG + Intergenic
913856966 1:123710381-123710403 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913857483 1:123719894-123719916 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913857561 1:123721253-123721275 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913857604 1:123721933-123721955 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913857641 1:123722612-123722634 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913858051 1:123729915-123729937 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913858110 1:123730936-123730958 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913858310 1:123734678-123734700 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913858331 1:123735018-123735040 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913858612 1:123740117-123740139 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913859120 1:123749290-123749312 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
913859184 1:123750311-123750333 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913859881 1:123762550-123762572 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913859995 1:123764593-123764615 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913860176 1:123767651-123767673 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913860233 1:123768670-123768692 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913860606 1:123775129-123775151 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913860722 1:123777168-123777190 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913861283 1:123787031-123787053 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913861566 1:123792130-123792152 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913862063 1:123801139-123801161 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913862350 1:123806234-123806256 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913862463 1:123808267-123808289 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913863033 1:123818464-123818486 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913863207 1:123821519-123821541 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913863604 1:123828655-123828677 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913863772 1:123831717-123831739 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913863818 1:123832565-123832587 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913863981 1:123835625-123835647 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864203 1:123839705-123839727 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864376 1:123842763-123842785 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864433 1:123843782-123843804 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864657 1:123847861-123847883 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864819 1:123850918-123850940 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864875 1:123851937-123851959 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913864985 1:123853976-123853998 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913865037 1:123854998-123855020 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913865319 1:123860096-123860118 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913865429 1:123862132-123862154 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913865931 1:123870975-123870997 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913866012 1:123872335-123872357 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913866531 1:123881515-123881537 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913866764 1:123885594-123885616 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913867112 1:123891714-123891736 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913867277 1:123894771-123894793 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913867443 1:123897817-123897839 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913867615 1:123900873-123900895 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913867779 1:123903762-123903784 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913868118 1:123909880-123909902 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913868172 1:123910899-123910921 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913868338 1:123913956-123913978 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913868903 1:123924152-123924174 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913869135 1:123928232-123928254 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913869410 1:123933329-123933351 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913869579 1:123936385-123936407 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913869636 1:123937406-123937428 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913869991 1:123943866-123943888 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913870162 1:123946929-123946951 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913870330 1:123949987-123950009 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913870402 1:123951345-123951367 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913870506 1:123953045-123953067 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913870982 1:123961200-123961222 CTGTTTGTAAAGTCTGTAAGGGG + Intergenic
913871092 1:123963240-123963262 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913871667 1:123973776-123973798 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913871833 1:123976833-123976855 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913872172 1:123982958-123982980 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913872981 1:123997563-123997585 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913873490 1:124006739-124006761 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913873545 1:124007759-124007781 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913873653 1:124009799-124009821 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913874053 1:124016940-124016962 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913874108 1:124017959-124017981 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913874443 1:124024074-124024096 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913874846 1:124031204-124031226 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913875196 1:124037324-124037346 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913875422 1:124041400-124041422 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913875481 1:124042412-124042434 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913876119 1:124053658-124053680 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913876346 1:124057740-124057762 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913876742 1:124064877-124064899 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913876818 1:124066236-124066258 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913877374 1:124076089-124076111 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913877485 1:124078127-124078149 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913877651 1:124081186-124081208 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913878241 1:124091378-124091400 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913878375 1:124093758-124093780 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913878473 1:124095460-124095482 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913878788 1:124100897-124100919 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913879197 1:124108035-124108057 CTGCTTGTAAAGTCTGTAAGTGG + Intergenic
913879312 1:124110036-124110058 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913879482 1:124113085-124113107 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913879746 1:124118185-124118207 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913879917 1:124121236-124121258 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913879973 1:124122255-124122277 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913880203 1:124126336-124126358 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913880601 1:124133470-124133492 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913880763 1:124136526-124136548 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913881210 1:124144685-124144707 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913881271 1:124145704-124145726 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913881666 1:124152838-124152860 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913881726 1:124153858-124153880 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913881897 1:124156916-124156938 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913881953 1:124157935-124157957 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913882459 1:124167102-124167124 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913882626 1:124170130-124170152 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913883074 1:124178288-124178310 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913883092 1:124178627-124178649 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913883131 1:124179307-124179329 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913883586 1:124187460-124187482 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913883913 1:124193241-124193263 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913883972 1:124194262-124194284 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913884322 1:124200379-124200401 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913884403 1:124201741-124201763 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913884863 1:124209904-124209926 CTGTTTGTACAGTCTGTAAGTGG + Intergenic
913885167 1:124215343-124215365 CTGCCTGTAAAGTCTGCAAGTGG + Intergenic
913885314 1:124218064-124218086 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913885435 1:124220104-124220126 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913885667 1:124224178-124224200 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913885892 1:124228257-124228279 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913886159 1:124233355-124233377 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913886672 1:124242534-124242556 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913886905 1:124246612-124246634 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913887013 1:124248651-124248673 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913887221 1:124252381-124252403 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913887360 1:124254762-124254784 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913887678 1:124260363-124260385 CTGTCTGTAAAGTCTGCACGTGG + Intergenic
913887699 1:124260703-124260725 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913887932 1:124264784-124264806 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913888281 1:124270897-124270919 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913888616 1:124277017-124277039 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913888673 1:124278037-124278059 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913888884 1:124281778-124281800 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913889486 1:124292654-124292676 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913889700 1:124296396-124296418 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913889818 1:124298435-124298457 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913889993 1:124301496-124301518 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913890104 1:124303537-124303559 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913890162 1:124304559-124304581 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913890722 1:124314757-124314779 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913890835 1:124316796-124316818 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913890945 1:124318837-124318859 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913891498 1:124329038-124329060 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913891668 1:124332099-124332121 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913892482 1:124346719-124346741 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913892526 1:124347400-124347422 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913892583 1:124348420-124348442 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913892702 1:124350461-124350483 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913892884 1:124353522-124353544 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913893243 1:124359643-124359665 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913893351 1:124361678-124361700 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913893461 1:124363720-124363742 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913893636 1:124366785-124366807 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913893859 1:124370866-124370888 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913893969 1:124372904-124372926 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913894029 1:124373924-124373946 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913894143 1:124375963-124375985 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913894201 1:124376982-124377004 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913894423 1:124381060-124381082 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913894805 1:124388026-124388048 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913895848 1:124406727-124406749 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913896280 1:124414545-124414567 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913896507 1:124418617-124418639 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913897015 1:124427794-124427816 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913897073 1:124428813-124428835 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913897244 1:124431873-124431895 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913897705 1:124440033-124440055 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913898341 1:124451253-124451275 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913898626 1:124456352-124456374 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913898682 1:124457371-124457393 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913898735 1:124458391-124458413 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913899009 1:124463148-124463170 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
913899029 1:124463488-124463510 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913899198 1:124466546-124466568 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913899778 1:124476744-124476766 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900002 1:124480824-124480846 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900229 1:124484900-124484922 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900399 1:124487959-124487981 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900624 1:124492036-124492058 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900639 1:124492375-124492397 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900731 1:124494076-124494098 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900787 1:124495095-124495117 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913900904 1:124497134-124497156 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913901241 1:124503248-124503270 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913901587 1:124509704-124509726 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913901847 1:124514464-124514486 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913902378 1:124523977-124523999 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913903005 1:124535184-124535206 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913903689 1:124547419-124547441 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913903749 1:124548438-124548460 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913904044 1:124553878-124553900 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913904331 1:124558969-124558991 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913904391 1:124559988-124560010 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913904786 1:124567131-124567153 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913904894 1:124569172-124569194 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913905065 1:124572235-124572257 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913905462 1:124579374-124579396 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913905746 1:124584472-124584494 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913905900 1:124587189-124587211 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913905999 1:124588888-124588910 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913906137 1:124591267-124591289 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913906273 1:124593650-124593672 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913906292 1:124593989-124594011 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
913906453 1:124596709-124596731 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913906559 1:124598748-124598770 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913906725 1:124601806-124601828 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913907011 1:124606903-124606925 CTGTTTGTAAAGTCTGTAAGAGG + Intergenic
913907126 1:124608943-124608965 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913907185 1:124609962-124609984 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913907241 1:124610983-124611005 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913907298 1:124612003-124612025 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913907413 1:124614042-124614064 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913907806 1:124621180-124621202 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913908257 1:124629337-124629359 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913908637 1:124636136-124636158 CTGGTTGTAAAGTCTGCAAGTGG + Intergenic
913908941 1:124641580-124641602 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913909093 1:124644299-124644321 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913909156 1:124645317-124645339 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913909375 1:124649397-124649419 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913909895 1:124658575-124658597 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913909948 1:124659592-124659614 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913910061 1:124661633-124661655 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913910231 1:124664688-124664710 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913910521 1:124669794-124669816 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913910579 1:124670814-124670836 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913911249 1:124683051-124683073 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913911647 1:124690188-124690210 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913912504 1:124705481-124705503 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913912628 1:124707520-124707542 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913912687 1:124708540-124708562 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913912801 1:124710581-124710603 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913913398 1:124721456-124721478 CTGGTTGTAAAGTCTGCACGTGG + Intergenic
913913480 1:124722816-124722838 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913913875 1:124729957-124729979 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913913991 1:124731995-124732017 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913914500 1:124741170-124741192 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913914614 1:124743212-124743234 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913914954 1:124749329-124749351 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913916087 1:124769716-124769738 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913916203 1:124771755-124771777 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913916319 1:124773791-124773813 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
913916598 1:124778886-124778908 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
915353247 1:155239739-155239761 CTGGCTGCAGGGTCAGTAGCAGG + Exonic
915724231 1:158006592-158006614 CTGGCTGGGGATACTGTAGGAGG - Intronic
916727479 1:167535681-167535703 CGGGAGGTAGAGTCTTTAGGAGG + Intronic
917596937 1:176538770-176538792 CTGGCAGTAGGGTTTATAGGTGG - Intronic
918014702 1:180622065-180622087 CTGCCTGTTGAGTCTCTAGGTGG + Intergenic
919054746 1:192555794-192555816 ATGACTGTAGAGTTTGTAGAGGG + Intergenic
919493426 1:198234571-198234593 CTGGTTGGTGAGTCAGTAGGAGG - Intronic
921069820 1:211649597-211649619 CTGGCTGGAGAGTCTGGAGATGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923356280 1:233159086-233159108 CTGGCTCCTGATTCTGTAGGTGG + Intronic
924064828 1:240210220-240210242 TTGGCTGTGGAATGTGTAGGTGG + Intronic
924770769 1:247078035-247078057 CTGGCTGCACAGTCTATATGGGG + Intronic
1062913653 10:1231025-1231047 CTGGCTGGAGAGGCTGCAGTTGG + Intronic
1063604270 10:7508563-7508585 CTGGCTGTGCAGTCTGGTGGAGG - Intergenic
1064674595 10:17748519-17748541 CTGGCTGTGGTTTCTTTAGGAGG - Intergenic
1066548733 10:36532023-36532045 CTGGGTGTCTAGTCTGTAGCAGG - Intergenic
1066816302 10:39419720-39419742 CTTGTTGTAGATTCTGTAAGTGG + Intergenic
1066817808 10:39444303-39444325 CTGGTTGTAGAATCTGCAAGTGG - Intergenic
1066825130 10:39561406-39561428 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1066825279 10:39564463-39564485 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1066828517 10:39691696-39691718 CTGTCTGTAAAGTCTGTAAGTGG + Intergenic
1066831748 10:39750148-39750170 CTGTCTGTAAGGTCTGCAGGTGG + Intergenic
1066834480 10:39799414-39799436 CTGTCTGTAAAGTCTGTAAGTGG + Intergenic
1066834768 10:39804511-39804533 CTGTCTGTAAGGTCTGCAGGTGG + Intergenic
1066835706 10:39821492-39821514 CTGTCTGTAAAGTCTGTAAGTGG + Intergenic
1066837037 10:39845608-39845630 CTGTCTGTAAAGTCTGTAAGTGG + Intergenic
1066837625 10:39856144-39856166 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1066840082 10:39900308-39900330 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1066840387 10:39905745-39905767 CTGTCTGTAAAGTCTGTAAGTGG + Intergenic
1066841802 10:39931232-39931254 CTGTCTGTAAGGTCTGCAGGTGG + Intergenic
1066863428 10:40359478-40359500 CTATCTGTAAAGTCTGTAAGTGG + Intergenic
1066880386 10:40696693-40696715 CTATCTGTAAAGTCTGTAAGTGG + Intergenic
1066892940 10:40943703-40943725 CTATCTGTAAAGTCTGTAAGTGG + Intergenic
1066895885 10:41002466-41002488 CTATCTGTAAAGTCTGTAAGTGG + Intergenic
1066897445 10:41033023-41033045 CTGTTTGTAGAGTCTGCAAGTGG + Intergenic
1066901058 10:41104327-41104349 CTATCTGTAAAGTCTGTAAGTGG + Intergenic
1066911171 10:41302354-41302376 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1066926624 10:41702270-41702292 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1066926927 10:41707701-41707723 CTGTTTGTAAAGTCTGCAGGAGG + Intergenic
1066935873 10:41834259-41834281 CTGTTTGTAAAGTCTGTAAGTGG - Intergenic
1067927524 10:50525324-50525346 CTGGCTCTAGATTGTGAAGGTGG + Intronic
1069069364 10:63977641-63977663 CTGGCTTTAGAGTCTGCACCAGG + Intergenic
1070977970 10:80620529-80620551 CTGGATGTAGAATCTGGATGTGG + Intronic
1073844033 10:107531986-107532008 CTTATTGTAGAGTCTGTAGAAGG + Intergenic
1074065126 10:110007407-110007429 CTGGCTGCTGGGGCTGTAGGAGG - Intronic
1074192109 10:111147078-111147100 CTGACTCTTGAGTCTGCAGGTGG + Intergenic
1075149578 10:119914917-119914939 CTTGCTGAGGAGTCTGTAAGAGG + Intronic
1076560830 10:131362257-131362279 CTTGGTGTGGAGTCTGTGGGAGG - Intergenic
1078157664 11:8812705-8812727 CTGTCAGTAGGCTCTGTAGGTGG - Intronic
1079214674 11:18498055-18498077 CTGGATGTTGAGTGTGTGGGTGG + Intronic
1080562056 11:33473112-33473134 GTGGCTGTAGTGTCTGTTTGGGG + Intergenic
1081340402 11:41920589-41920611 CTGCCTGCAGAATCTGTAAGGGG + Intergenic
1081967889 11:47180454-47180476 CTGGCTGAAGAGGCTGAAGGAGG - Exonic
1082336049 11:51289136-51289158 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082361102 11:51653674-51653696 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1082377435 11:51890845-51890867 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1082381245 11:51946225-51946247 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082383286 11:51975978-51976000 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082385321 11:52005737-52005759 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082402113 11:52249846-52249868 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082403940 11:52276365-52276387 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1082405706 11:52301842-52301864 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082409756 11:52360165-52360187 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1082416791 11:52461522-52461544 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082417141 11:52466622-52466644 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1082419019 11:52493825-52493847 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082423599 11:52560138-52560160 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082424186 11:52568641-52568663 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1082425356 11:52585637-52585659 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082432045 11:52682522-52682544 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082455482 11:53021677-53021699 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1082470269 11:53235266-53235288 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082473293 11:53279467-53279489 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082473414 11:53281167-53281189 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1082474938 11:53303272-53303294 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082480115 11:53378094-53378116 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082495351 11:53597013-53597035 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082498070 11:53636111-53636133 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082501577 11:53686787-53686809 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082502846 11:53705492-53705514 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1082509939 11:53808359-53808381 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082523560 11:54005119-54005141 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1082526316 11:54044890-54044912 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1082529310 11:54088253-54088275 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082529784 11:54095057-54095079 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1082533996 11:54156281-54156303 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1082549579 11:54378408-54378430 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1084265802 11:68004553-68004575 CTGGCTGTAGCGTCCGGTGGTGG - Intronic
1084314478 11:68337082-68337104 CTGACTGTAGAATGTGTTGGGGG + Intronic
1088969938 11:114764531-114764553 CTGGGTGAGGAGTCTATAGGTGG + Intergenic
1090381475 11:126330610-126330632 CTGGCTGCAGAGTCTGTGCCTGG + Intronic
1090793355 11:130111922-130111944 CAGGCTGCAAAGTCTTTAGGGGG - Intronic
1091045182 11:132318833-132318855 ATGGCTGTAGACTTTGGAGGTGG + Intronic
1091560186 12:1606243-1606265 CTGGCTGTGAACTCTGTAGCTGG - Intronic
1094879001 12:34692157-34692179 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
1094879664 12:34706177-34706199 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1094879807 12:34708894-34708916 CTGGCTATAAAGTCTGCAAGTGG + Intergenic
1094892752 12:34983153-34983175 CTGTCTGTAAAGTCTGCAAGCGG + Intergenic
1094923889 12:35487236-35487258 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1094936674 12:35694215-35694237 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1094946837 12:35858964-35858986 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1094955873 12:36005377-36005399 CTGTCTGTAAAGTCTGCAAGCGG + Intergenic
1094966614 12:36178972-36178994 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1094970737 12:36245210-36245232 CTGTCTGTAAAGTCTGCAAGCGG + Intergenic
1094972805 12:36278507-36278529 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1094980655 12:36405213-36405235 CTGTCTGTAAAGTCTGCAAGCGG + Intergenic
1094985557 12:36484726-36484748 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1094990417 12:36563547-36563569 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1095013448 12:36936571-36936593 CTGTCTGTAAAGTCTGCAAGCGG + Intergenic
1095019657 12:37036892-37036914 CTGTCTGTAAAGTCTGCAAGGGG + Intergenic
1095030603 12:37271104-37271126 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1095030684 12:37272460-37272482 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1095036574 12:37385684-37385706 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1095057190 12:37624450-37624472 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1097666876 12:62488442-62488464 CTGACTGTAGAGTATGAAGGGGG + Intronic
1097787844 12:63780257-63780279 CTGGCTCGAGAGGCTGTAGGGGG - Intronic
1100694912 12:97082164-97082186 GTGGATGTAGAGTGTGTAGATGG + Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102050251 12:109856689-109856711 AGGGCTGAAGAGTCTGTAGCTGG + Intronic
1103059533 12:117847570-117847592 CTGGCTGCAGAGTCGATGGGTGG - Intronic
1105079355 13:16088269-16088291 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1107273463 13:38648505-38648527 CTGGCTGATGTGACTGTAGGAGG - Intergenic
1108993404 13:56693900-56693922 CTTTCTGTTGTGTCTGTAGGTGG + Intergenic
1111953162 13:94726896-94726918 CAGGTTGTAAAGTATGTAGGAGG + Intergenic
1112092247 13:96093680-96093702 CTTGCTCTAGATACTGTAGGAGG + Intronic
1114000151 14:18229230-18229252 CTTTTTGTAGAGTCTGTAAGTGG - Intergenic
1119640458 14:76310598-76310620 GTGGCTGTGGAGTCTGCATGGGG + Intronic
1119734601 14:76973882-76973904 CTGGCTGCAGCTTCTGAAGGAGG + Intergenic
1121713950 14:96059619-96059641 CTGGCAGTAGTGTCTGCTGGGGG + Intronic
1123224782 15:17012478-17012500 CTGTTTGTAGAGTCTGCAAGTGG + Intergenic
1123291560 15:18174294-18174316 CTCTTTGTAGAGTCTGCAGGTGG + Intergenic
1124614503 15:31231683-31231705 CTGGGAGTAGAGTCGGGAGGGGG - Intergenic
1125127201 15:36238182-36238204 CTGGCTGTGGCGTCTGGATGTGG + Intergenic
1126989394 15:54355069-54355091 CTCTCTGTAGAGTCTGGAGGGGG - Intronic
1132324935 15:100961137-100961159 CTGGCTGCAGAGTCCTGAGGTGG + Intronic
1133035251 16:3030698-3030720 GCGGCTGGAGAGTCTGCAGGGGG - Exonic
1133055977 16:3145680-3145702 GTGGCTGAAGAGTCCGCAGGGGG + Exonic
1133138934 16:3730656-3730678 CTTGCTGTGGTGTCTGTAGCGGG - Intronic
1133716924 16:8458771-8458793 CTGGCTTTACAGTCTGGAGCAGG + Intergenic
1136915635 16:34192640-34192662 CTTTTTGTAGAATCTGTAGGTGG - Intergenic
1136915850 16:34196215-34196237 CTTTCTGTAGAATCTGCAGGTGG - Intergenic
1136917631 16:34222805-34222827 CTTTTTGTAGAGTCTGCAGGTGG + Intergenic
1137077094 16:35981885-35981907 CTCTCTGTAGAATCTGCAGGTGG + Intergenic
1137104340 16:36439651-36439673 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
1137156976 16:37311041-37311063 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1137160691 16:37372860-37372882 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1137171822 16:37557003-37557025 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1137175700 16:37620865-37620887 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1137187343 16:37813793-37813815 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1137190847 16:37871881-37871903 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1137214756 16:38266625-38266647 CTGTTTGTAAAGTCTGTACGTGG - Intergenic
1137991746 16:53164166-53164188 CTGGCTTTAGAATCTTTAAGTGG + Intronic
1139911650 16:70400965-70400987 TTGGCTGAACAGTCTGTAGATGG + Intronic
1140673160 16:77298983-77299005 CTGGATTTAGATTCTGTAAGTGG + Intronic
1143078429 17:4365174-4365196 CTGGTTTTAGAGTGGGTAGGGGG + Intronic
1144729508 17:17518432-17518454 CTGGCTGTGGAGTGTGAATGGGG - Intronic
1145439292 17:23082309-23082331 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1145652510 17:26177870-26177892 CTGTTTGTAGAATCTGCAGGTGG + Intergenic
1145679091 17:26564512-26564534 CTTGCTGTAGAATCTGCAAGTGG + Intergenic
1148820564 17:50357234-50357256 CCGGCTCCAGAGTCTGGAGGTGG + Exonic
1150690511 17:67362714-67362736 CTGGCTGCAGAGCCTGTAGTGGG - Intronic
1151222205 17:72621444-72621466 GTGGCTGTAGAGACAGTAGGTGG + Intergenic
1151624114 17:75265914-75265936 CTGGTGGTAGAGTCTCCAGGAGG + Exonic
1154907462 18:20595192-20595214 CTGTCTGTAGAATCTGCAAGTGG - Intergenic
1154924166 18:20856014-20856036 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1154924234 18:20857037-20857059 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1154924398 18:20859590-20859612 CTGTCTGTAGAATCTGCAAGTGG + Intergenic
1155961197 18:31996545-31996567 CTGAAAGTAAAGTCTGTAGGTGG + Intergenic
1158199001 18:54919452-54919474 GTAGCAGTAGAGTGTGTAGGAGG - Intronic
1159710513 18:71752282-71752304 AAGGCTGTGGAGCCTGTAGGTGG - Intronic
1160802486 19:976816-976838 TGGGATGCAGAGTCTGTAGGGGG + Intergenic
1161591074 19:5129278-5129300 CTGGCTGCAGGGTCTGTTGGGGG + Intronic
1164342512 19:24420927-24420949 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164342523 19:24421098-24421120 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164342702 19:24423823-24423845 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164342713 19:24423994-24424016 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164342892 19:24426719-24426741 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164342903 19:24426890-24426912 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164343082 19:24429615-24429637 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164343093 19:24429786-24429808 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164343273 19:24432511-24432533 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164343285 19:24432682-24432704 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164343463 19:24435406-24435428 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164343638 19:24438129-24438151 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164343649 19:24438300-24438322 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164343825 19:24441024-24441046 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164343836 19:24441195-24441217 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164344012 19:24443919-24443941 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164344023 19:24444090-24444112 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164344209 19:24446986-24447008 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
1164344220 19:24447157-24447179 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1164350728 19:27336056-27336078 CTGTCTGTAGAATCTGCAAGTGG - Intergenic
1164350875 19:27338955-27338977 CTCTTTGTAGAATCTGTAGGTGG - Intergenic
1166475583 19:43121957-43121979 CTGGCAGTAGTGTCTGGAGGAGG + Intronic
1167478995 19:49717659-49717681 CTGACCGTAGAGCCTGAAGGAGG + Intergenic
924994269 2:342595-342617 CTAGCTGTAGAATTTGCAGGTGG - Intergenic
925070202 2:960634-960656 ATGGCTGTAGGTTCTGAAGGGGG + Intronic
925697328 2:6594766-6594788 GTGGGTGTAGAGTGTGTTGGTGG - Intergenic
925768620 2:7261195-7261217 CAGGCTGTAGAGTTAGTGGGAGG + Intergenic
929718053 2:44333571-44333593 CTGGCTGTAGTTGCTGCAGGTGG - Intronic
935166915 2:100577969-100577991 CTGGCTCTAGTGTATGTGGGCGG - Intergenic
935957190 2:108388882-108388904 CAGGTTGTAGTGTTTGTAGGAGG - Intergenic
939163137 2:138612444-138612466 CTGGCTGTAGAGTATCAAGCAGG + Intergenic
939230623 2:139421243-139421265 CTGACTATAGTGTGTGTAGGGGG + Intergenic
940343503 2:152605097-152605119 CTTGCTGTAGATTGTCTAGGGGG + Intronic
942327024 2:174784548-174784570 CTGGCTGGCGGGTCTGTAGCTGG + Intergenic
946755287 2:222939277-222939299 CTGGCTCTAGAATCCGTAGTAGG - Intronic
1169384321 20:5135410-5135432 CTGGCACTAGAGGCTGTTGGGGG + Intronic
1171577610 20:26350698-26350720 CTTTCTGAAGAATCTGTAGGTGG + Intergenic
1171766502 20:29286446-29286468 CTTTTTGTAGAGTCTGTAAGTGG - Intergenic
1172759464 20:37311864-37311886 CGGGCAGGAGAGTCTGTGGGAGG + Intronic
1173049438 20:39545255-39545277 GTGGGGGTAGATTCTGTAGGTGG - Intergenic
1173164073 20:40673947-40673969 CTGGCTGTGGAGACTGGAGCTGG - Intergenic
1173180272 20:40801325-40801347 CTGGCTGGAGGGTCTTTTGGGGG + Intergenic
1175998523 20:62821858-62821880 CTGGCTGTTGAGTCTGGGGGTGG - Intronic
1176159197 20:63640117-63640139 CTTGCTGTAAAGTGTGAAGGGGG - Exonic
1176533940 21:8012889-8012911 CTTTCTGTAGAATCTGCAGGTGG - Intergenic
1176534342 21:8020718-8020740 CTTTCTGTAGAATCTGCAGGTGG - Intergenic
1176534453 21:8023097-8023119 CTTTCTGTAGAATCTGCAGGTGG - Intergenic
1180325143 22:11365806-11365828 CTTTTTGTAGAGTCTGCAGGTGG + Intergenic
1180424615 22:15159003-15159025 CTTTTTGTAGAGTCTGTAAGTGG - Intergenic
1180426594 22:15196703-15196725 CTGTTTGTAGAATCTGTATGTGG - Intergenic
1180503482 22:15963936-15963958 CTTTTTGTAGAATCTGTAGGTGG + Intergenic
1180504195 22:15976962-15976984 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1181842066 22:25671686-25671708 CTGGCTGTAGAGTCTGTAGGAGG + Intronic
1203334382 22_KI270739v1_random:45550-45572 CTTTCTGTAGAGTCTGCAAGTGG - Intergenic
1203335092 22_KI270739v1_random:58576-58598 CTTTTTGTAGAATCTGTAGGTGG - Intergenic
949433723 3:4005839-4005861 ATGGTTGTAGAGCCTGTGGGAGG - Intronic
950673749 3:14542044-14542066 CTGACTGAAGAGGCTGTAGATGG - Exonic
951427364 3:22563302-22563324 CTGGCTTTAGAGACAGAAGGGGG + Intergenic
958403201 3:93715558-93715580 CTGTTTGTAAAGTCTGTAAGTGG - Intergenic
958408664 3:93784404-93784426 CTTTTTGTAGAGTCTGCAGGTGG - Intergenic
961505147 3:127365666-127365688 CAGGCTGTGGAATCTGAAGGCGG + Intergenic
963828194 3:149978705-149978727 CTGGCTGTAGAGTATGTGAGAGG + Intronic
966922182 3:184619630-184619652 CTGGCTGTGGGGGCTGTACGTGG + Intronic
969050672 4:4370758-4370780 TTGGCTACAAAGTCTGTAGGTGG + Intronic
969056979 4:4408235-4408257 TTGGCTGTAGGGTCTGTATGTGG + Intronic
972370319 4:38417211-38417233 CTGGAGGTGGAGTCTGTGGGAGG - Intergenic
973481330 4:50981739-50981761 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
976607869 4:86999394-86999416 CTGCCTCTAGGGTCTGTAAGGGG - Intronic
977299496 4:95252062-95252084 CTGAATGTAGAGTCTGTATTTGG - Intronic
979596763 4:122542894-122542916 CTAGCTGTAGAGTCATTTGGGGG + Intergenic
981852269 4:149244707-149244729 CTGGGTCTAGAATCTGTAGGGGG + Intergenic
983783344 4:171700769-171700791 CTGGGTGTGGACTCTTTAGGAGG + Intergenic
987173090 5:15279152-15279174 CTGGAGGTAGGGCCTGTAGGAGG + Intergenic
989859563 5:46351504-46351526 CTTTCTGTAGATTCTGTAAGAGG - Intergenic
989859820 5:46356590-46356612 CTTTCTGTAGATTCTGTAAGCGG - Intergenic
989907664 5:47283572-47283594 CTGTTTGTAAAGTCTGTACGTGG + Intergenic
989909560 5:49612486-49612508 CTGTTTGTAAAGTCTGTAAGTGG - Intergenic
989909679 5:49614525-49614547 CTGTTTGTAAAGTCTGTAAGTGG - Intergenic
989909839 5:49617244-49617266 CTGTTTGTAAAGTCTGTAAGTGG - Intergenic
989910774 5:49647434-49647456 CTGTTTGTAAAGTCTGTAAGGGG + Intergenic
989910892 5:49649473-49649495 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
989912285 5:49671200-49671222 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989912466 5:49674097-49674119 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989912477 5:49674268-49674290 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989912645 5:49676992-49677014 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989912828 5:49679888-49679910 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989912840 5:49680059-49680081 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989913010 5:49682786-49682808 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989913189 5:49685682-49685704 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989913358 5:49688405-49688427 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989913368 5:49688576-49688598 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989913542 5:49691303-49691325 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989913739 5:49694200-49694222 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989913750 5:49694371-49694393 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989914111 5:49699987-49700009 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989914124 5:49700158-49700180 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989914485 5:49705783-49705805 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989914496 5:49705954-49705976 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989914667 5:49708681-49708703 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989914857 5:49711585-49711607 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989915048 5:49714478-49714500 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989915059 5:49714649-49714671 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989915235 5:49717373-49717395 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989915246 5:49717544-49717566 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
989915421 5:49720268-49720290 CTTGTTGTAGAATCTGCAGGTGG + Intergenic
989923564 5:49841332-49841354 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
989925536 5:49869951-49869973 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
989927311 5:49896523-49896545 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
989947426 5:50255802-50255824 CTTCCTGTAGAATCTGTAGAGGG - Intergenic
991533829 5:67644655-67644677 TTGGGTGTAGAGCCTTTAGGAGG + Intergenic
993436496 5:87901959-87901981 CTGCCTGTAGACTCTGCAGGAGG + Intergenic
997752288 5:136357812-136357834 TGTGCTGCAGAGTCTGTAGGAGG + Intronic
998066343 5:139162076-139162098 GGAGCTGTAGAGACTGTAGGGGG - Intronic
999911005 5:156199138-156199160 CTGCCTGTAGAGTCTGTACATGG + Intronic
1002190593 5:177475383-177475405 GTGGCTGGAGAGTTTGTAGGTGG - Intergenic
1003655060 6:7999421-7999443 CTGGCTGTTGAGCCTGTACAAGG - Intronic
1004043504 6:12005963-12005985 CTGGAGATAGAGTCTTTAGGAGG + Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1006811879 6:36825416-36825438 CTGGATGTAGAGACTGGAGTTGG - Intronic
1006883230 6:37357371-37357393 CTGGGTTCAGAGTCTGTTGGAGG + Intronic
1006987508 6:38185872-38185894 CGGGCTGCAGGGACTGTAGGTGG - Intronic
1009130172 6:59456676-59456698 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1009255844 6:61396649-61396671 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1012548937 6:100450222-100450244 CTGGCTGTAAACACTGCAGGTGG + Intronic
1012551205 6:100465980-100466002 CCGGGAGTCGAGTCTGTAGGGGG - Intergenic
1013606891 6:111758941-111758963 CTGGCTGGAGAGTGTGTGAGGGG - Intronic
1014081647 6:117293336-117293358 TGGGCTGTAGATTCTGTAGTAGG - Intronic
1015006537 6:128288751-128288773 CTGACTATAGAGTGTGAAGGGGG - Intronic
1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG + Intronic
1017993264 6:159508805-159508827 TTGGCTGTAAAGTCTGAATGGGG - Intergenic
1018147407 6:160905411-160905433 CAGGCTGTGCAGGCTGTAGGTGG - Intergenic
1018148219 6:160913126-160913148 CAGGCTGTACAGGCTGTAGGTGG - Intergenic
1018236269 6:161727021-161727043 CTGCCTGTAGTGTCTGGACGAGG + Intronic
1018719953 6:166565009-166565031 CTGGCTGTAGACTCTGAATGGGG - Intronic
1019461911 7:1164105-1164127 CTGTCTGTAAAATCTGCAGGAGG - Intergenic
1019695658 7:2444724-2444746 CTGGGTGGAGAGTCTGCGGGAGG + Intergenic
1021523926 7:21565330-21565352 CTGGATATAGGGTCTTTAGGAGG - Intronic
1023364580 7:39451022-39451044 CGGACTCTAGAGTCTGTAAGAGG + Intronic
1023714605 7:43030323-43030345 CTGTCTGGGGAGTCTGCAGGCGG + Intergenic
1025311920 7:57957045-57957067 CTGTTTGTAGAATCTGCAGGTGG - Intergenic
1025315964 7:58029630-58029652 CTTGTTGTAGAATCTGTAAGTGG + Intergenic
1025323377 7:58174675-58174697 CTGTCTGTAAAGTCTGCAAGTGG + Intergenic
1025342406 7:58511901-58511923 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1025352066 7:58683257-58683279 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025364405 7:58901741-58901763 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025368895 7:58981117-58981139 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025372562 7:59046186-59046208 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025403412 7:59593469-59593491 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025405297 7:59626854-59626876 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025422083 7:59924619-59924641 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025427128 7:60014572-60014594 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1025434307 7:60142311-60142333 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025434442 7:60144695-60144717 CTGTTTGTAGAGTCTGCAAGTGG + Intergenic
1025439723 7:60238390-60238412 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1025447634 7:60379098-60379120 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025464981 7:60688124-60688146 CTGTTTGTAAAGTCTGCAGGTGG + Intergenic
1025465173 7:60691529-60691551 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1025465966 7:60705835-60705857 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1025490603 7:61115960-61115982 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025490766 7:61118695-61118717 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025490925 7:61121430-61121452 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025491087 7:61124164-61124186 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025491248 7:61126898-61126920 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025491409 7:61129632-61129654 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025491565 7:61132366-61132388 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025491724 7:61135100-61135122 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025492032 7:61140396-61140418 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025492351 7:61145864-61145886 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025492515 7:61148598-61148620 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025492678 7:61151332-61151354 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025492837 7:61154065-61154087 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025492995 7:61156799-61156821 CTTTCTGTAGAATCTGGAGGTGG + Intergenic
1025493155 7:61159533-61159555 CTTTCTGTAGAATCTGGAGGTGG + Intergenic
1025493318 7:61162267-61162289 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025493478 7:61165001-61165023 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025493641 7:61167735-61167757 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025493798 7:61170469-61170491 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025494004 7:61174059-61174081 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025494164 7:61176793-61176815 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025494321 7:61179527-61179549 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025494622 7:61184654-61184676 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025494782 7:61187388-61187410 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025494939 7:61190120-61190142 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025495100 7:61192854-61192876 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025495271 7:61195760-61195782 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025495432 7:61198494-61198516 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025495595 7:61201228-61201250 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025495756 7:61203962-61203984 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025496074 7:61209429-61209451 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025496237 7:61212163-61212185 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025496399 7:61214897-61214919 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025496563 7:61217631-61217653 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025496883 7:61223098-61223120 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497043 7:61225832-61225854 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497202 7:61228566-61228588 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497219 7:61228907-61228929 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497376 7:61231641-61231663 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497540 7:61234375-61234397 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497701 7:61237109-61237131 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025497861 7:61239843-61239865 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025498009 7:61242577-61242599 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025498172 7:61245311-61245333 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025498334 7:61248045-61248067 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025498491 7:61250778-61250800 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025498807 7:61256246-61256268 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025499136 7:61262056-61262078 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025499877 7:61274333-61274355 CTTGCTGTAGATTCTGCAAGTGG + Intergenic
1025502987 7:61380095-61380117 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025503152 7:61382829-61382851 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025503315 7:61385564-61385586 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025503474 7:61388299-61388321 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025503633 7:61391033-61391055 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025503790 7:61393767-61393789 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025503950 7:61396501-61396523 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025504110 7:61399235-61399257 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025504271 7:61401969-61401991 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025504434 7:61404703-61404725 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025504595 7:61407437-61407459 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025504758 7:61410171-61410193 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025504919 7:61412905-61412927 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025505080 7:61415638-61415660 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025505242 7:61418373-61418395 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025505406 7:61421107-61421129 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025505570 7:61423838-61423860 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025505735 7:61426572-61426594 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025505915 7:61429476-61429498 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025506233 7:61434945-61434967 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025506397 7:61437679-61437701 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025506550 7:61440413-61440435 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025506714 7:61443146-61443168 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025506877 7:61445880-61445902 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025507031 7:61448609-61448631 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025507196 7:61451363-61451385 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025507359 7:61454097-61454119 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025507525 7:61456834-61456856 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025507690 7:61459571-61459593 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025507854 7:61462306-61462328 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025508176 7:61467774-61467796 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025508337 7:61470508-61470530 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025508498 7:61473242-61473264 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025508656 7:61475976-61475998 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025508817 7:61478710-61478732 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025508975 7:61481443-61481465 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025509141 7:61484185-61484207 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025509302 7:61486918-61486940 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025509459 7:61489653-61489675 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025509784 7:61495121-61495143 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025509945 7:61497855-61497877 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025510105 7:61500590-61500612 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025510266 7:61503324-61503346 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025510428 7:61506059-61506081 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025510591 7:61508793-61508815 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025510761 7:61511525-61511547 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025510914 7:61514261-61514283 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025511072 7:61516995-61517017 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025511406 7:61522465-61522487 CTTTCTGTAGAATCTGGAGGAGG + Intergenic
1025511571 7:61525199-61525221 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025511730 7:61527935-61527957 CTTTCTGTAGAATCTGGAGGCGG + Intergenic
1025514730 7:61620542-61620564 CTTGCTGTAGATTCTGCAAGTGG + Intergenic
1025539076 7:62049382-62049404 CTTGCTGTAGATTCTGCAAGTGG + Intergenic
1033347201 7:140534694-140534716 CTTGCTGCAGAGTGTGGAGGTGG + Intronic
1035583522 8:755158-755180 CTGGATTTAGAGTCTGTGGAGGG + Intergenic
1036425406 8:8641393-8641415 CTGGAGGCAGAGTGTGTAGGAGG - Intergenic
1038252076 8:25914343-25914365 CTGGGTGTAGACTCTGCTGGGGG - Intronic
1040160809 8:44264537-44264559 CTTTTTGTAGAATCTGTAGGTGG + Intergenic
1040168850 8:44383521-44383543 CTTTTTGTAGAATCTGTAGGTGG + Intergenic
1040179418 8:44539750-44539772 CTTTTTGTAGAATCTGTAGGTGG + Intergenic
1040266274 8:45823235-45823257 CTTTTTGTAGAATCTGTAGGTGG + Intergenic
1040321012 8:46302353-46302375 CTGTTTGTAGAATCTGTAAGGGG - Intergenic
1041891009 8:62868989-62869011 CTGGCAGTAGACTCTGTTGATGG + Intronic
1042677695 8:71340145-71340167 CTGGCTGTAGGGTCTTCAGCAGG + Intronic
1044505168 8:93008119-93008141 CAGGTTCTAGAGCCTGTAGGGGG + Intronic
1046806513 8:118485209-118485231 CTGGGTGTGGAGTGTGAAGGTGG - Intronic
1050398684 9:5228104-5228126 CTGTCTCTAGAGTCTGGAGCTGG - Intergenic
1053936376 9:43158887-43158909 CTTTCTGTAGAATCTGTAAGGGG + Intergenic
1055719365 9:79154439-79154461 CAGGCTGTAGACTGTGGAGGAGG - Intergenic
1059285534 9:113168742-113168764 CTGGCTGTAGGTTCTGGAGGGGG - Intronic
1060559547 9:124531537-124531559 CAGGCTGTGGAGTCTGTAATTGG - Intronic
1203339036 Un_KI270304v1:1634-1656 CTGTTTGTAAAGTCTGTAAGTGG - Intergenic
1203340359 Un_KI270315v1:907-929 CTGTTTGTAAAGTCTGTAAGTGG + Intergenic
1203340689 Un_KI270317v1:687-709 CTGGTTGTAAAGTCTGCAAGTGG - Intergenic
1203420342 Un_KI270372v1:1412-1434 CTTGCTGTAGATTCTGCAAGTGG - Intergenic
1203420477 Un_KI270375v1:324-346 CTTGCTGTAGATTCTGCAAGTGG - Intergenic
1203341900 Un_KI270423v1:809-831 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1203356223 Un_KI270442v1:149367-149389 CTGTTTGTAGAATCTGTAAGTGG - Intergenic
1203373001 Un_KI270442v1:329952-329974 CTTTTTGTAGAGTCTGCAGGTGG + Intergenic
1203374281 Un_KI270442v1:350247-350269 CTTTTTGTAGAGTCTGTAAGTGG + Intergenic
1203420804 Un_KI270448v1:1483-1505 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1203406789 Un_KI270538v1:28808-28830 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1203686037 Un_KI270757v1:61236-61258 CTTTCTGTAGAATCTGCAGGTGG - Intergenic
1186608976 X:11120215-11120237 CTGTCTGTCTAGCCTGTAGGTGG + Intronic
1186910198 X:14155649-14155671 CTCTCTGCAGAGTCTGCAGGTGG - Intergenic
1190418132 X:50200987-50201009 CTGGCAGTCAAGGCTGTAGGAGG - Exonic
1190523093 X:51299662-51299684 ATGGCTCTACAGTCAGTAGGTGG - Intergenic
1191295011 X:58852515-58852537 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1191302237 X:58948849-58948871 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1191324496 X:59246041-59246063 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191359497 X:59713894-59713916 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191403298 X:60299808-60299830 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1191430176 X:60660162-60660184 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191431698 X:60680730-60680752 CTTTCTGTAGAGTCTGCAAGTGG + Intergenic
1191436716 X:60747748-60747770 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191447145 X:60886956-60886978 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191466591 X:61147362-61147384 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191475011 X:61260150-61260172 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191475916 X:61272491-61272513 CTTTCTGTAGAATCTGTAAGTGG + Intergenic
1191488287 X:61438118-61438140 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1191519937 X:61861186-61861208 CTTTCTGTAGAATCTGCAGGTGG + Intergenic
1191537341 X:62093898-62093920 CTTTTTGTAGAGTCTGTAAGTGG + Intergenic
1191558676 X:62379351-62379373 CTTTTTGTAGAGTCTGTAAGTGG + Intergenic
1191569509 X:62592287-62592309 CTGTTTGTAGAATCTGCAGGTGG + Intergenic
1193073551 X:77332377-77332399 CTGGCTGTGGAGAGTGTAGATGG - Intergenic
1193297072 X:79846044-79846066 ATGGCTGTACAGTCAGCAGGTGG + Intergenic
1194959947 X:100223780-100223802 CAGGCTGCAGAGGCTGTAGGAGG - Intergenic
1195013028 X:100752024-100752046 GTGGCTTTAGAGTCTGAAGATGG + Intergenic
1196691099 X:118559308-118559330 CTGGCTGTTGACTCTGCAAGTGG + Intronic
1198488326 X:137110974-137110996 CTGGGTGAAGAGTATCTAGGTGG - Intergenic
1198915859 X:141670879-141670901 CAGGATGTAAAGTCTGTAGAGGG - Intronic
1201095079 Y:10598867-10598889 CTTTCTGTAGAGTCTGCAAGTGG - Intergenic